G775600



Basic Information


Item Value
gene id G775600
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048573.1
NCBI id CM023227.2
chromosome length 79455637
location 16042380 ~ 16042743 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU883811
gcttctgggttagtggcagctctaccctttagctcagtgcaaatgttgcctataatccttggcttctggttggggtatgtacgtacagtcactgtggcaatgatgtcctcgatgcacttattgataaagctagtgactgatgtggtatactcctcaatgccatcggaagaatcccggaacatgttccagtctgtgctagcaaaacagtcctgtagtttagcatctgcttcatctgaccacttttttatagaccgagtcactggtgcttcctgctttaatttttgcttgtaagcaggaatcaggaggatagaattatggtcagatttgccaaatggagggcgagggagacctttgtatgcatctc

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU883811 True 364 lncRNA 0.45 1 16042380 16042743

Neighbor


gene id symbol gene type direction distance location
LOC110531610 LOC106577838 coding downstream 12482 15991941 ~ 16029898 (-)
trnal-cag-5 NA coding downstream 28762 16013536 ~ 16013618 (-)
LOC110531609 LOC106577837 coding downstream 62579 15951928 ~ 15979801 (-)
LOC110532935 LOC106577836 coding downstream 151111 15867906 ~ 15891269 (-)
LOC118966003 NA coding downstream 185174 15854217 ~ 15857206 (-)
LOC110531611 LOC106577839 coding upstream 6001 16048744 ~ 16087030 (-)
LOC110531612 LOC106577840 coding upstream 53219 16095962 ~ 16117909 (-)
trnak-cuu-4 NA coding upstream 90302 16133045 ~ 16133117 (-)
trnan-guu-3 NA coding upstream 90862 16133605 ~ 16133678 (-)
gba2 gba2 coding upstream 143514 16186257 ~ 16220121 (-)
G775599 NA non-coding downstream 47 16041968 ~ 16042333 (-)
G775596 NA non-coding downstream 4470 16037523 ~ 16037910 (-)
G775594 NA non-coding downstream 8032 16034033 ~ 16034348 (-)
G775591 NA non-coding downstream 12738 16028964 ~ 16029642 (-)
G775585 NA non-coding downstream 27015 16015041 ~ 16015365 (-)
G775602 NA non-coding upstream 746 16043489 ~ 16043792 (-)
G775603 NA non-coding upstream 2869 16045612 ~ 16047293 (-)
G775612 NA non-coding upstream 21183 16063926 ~ 16065846 (-)
G775645 NA non-coding upstream 77524 16120267 ~ 16127928 (-)
G775650 NA non-coding upstream 86050 16128793 ~ 16129615 (-)
G775532 NA other downstream 129086 15912836 ~ 15913294 (-)
G775139 NA other downstream 178546 15862320 ~ 15863834 (-)
LOC110531603 groa other downstream 254774 15781909 ~ 15787666 (-)
G774954 NA other downstream 416460 15625202 ~ 15625920 (-)
G774702 LOC106577875 other downstream 681061 15352307 ~ 15361319 (-)
LOC110531626 LOC106608856 other upstream 784310 16827053 ~ 16828583 (-)
G776294 NA other upstream 822724 16865467 ~ 16866034 (-)
G776340 LOC106577790 other upstream 967269 17010012 ~ 17014685 (-)
G776355 NA other upstream 982637 17025380 ~ 17025813 (-)
G776461 NA other upstream 1202691 17245434 ~ 17245797 (-)

Expression


G775600 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 50.
End of interactive chart.

G775600 Expression in each Bioproject

Bar chart with 21 bars.
G775600 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1500.
End of interactive chart.

Co-expression Network