G775945



Basic Information


Item Value
gene id G775945
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048573.1
NCBI id CM023227.2
chromosome length 79455637
location 16683194 ~ 16683491 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU884223
ggagagagatggggagagagatggatggaaggagagagagatggggagagagatggatggaaggagagagagatggatggaaggagagagatggggagagagatggatggaaggagagagagatggggagagagatggatggaaggagagagagatggatggaaggagagagatggggagagagatggatggaaggagagagagatggggagagagatggatggaaggagagagagatggggagagagatggatggaaggagagagagatggggagagagatggatggaaggagagag

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU884223 True 298 TUCP 0.53 1 16683194 16683491
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110531622 LOC106577817 coding upstream 89589 16589215 ~ 16593605 (+)
LOC110531621 LOC106577824 coding upstream 94809 16582409 ~ 16588385 (+)
LOC110531620 LOC106577818 coding upstream 209794 16454905 ~ 16473400 (+)
LOC110533002 LOC106577819 coding upstream 239180 16440652 ~ 16444014 (+)
LOC110531617 NA coding upstream 303617 16366488 ~ 16379577 (+)
LOC110531623 LOC106577803 coding downstream 94043 16777534 ~ 16821342 (+)
LOC110531624 LOC106577801 coding downstream 145295 16828786 ~ 16839453 (+)
LOC110531630 NA coding downstream 208852 16892343 ~ 16907677 (+)
LOC110531629 LOC106577796 coding downstream 230579 16914070 ~ 16925975 (+)
acin1b LOC106577794 coding downstream 242721 16926212 ~ 16953584 (+)
G775942 NA non-coding upstream 2076 16680553 ~ 16681118 (+)
G775938 NA non-coding upstream 12168 16670603 ~ 16671026 (+)
G775937 NA non-coding upstream 13572 16669269 ~ 16669622 (+)
G775935 NA non-coding upstream 19501 16662811 ~ 16663693 (+)
G775934 NA non-coding upstream 21784 16660587 ~ 16661410 (+)
G775953 LOC106674859 non-coding downstream 9905 16693396 ~ 16694150 (+)
G776009 NA non-coding downstream 96219 16779710 ~ 16780105 (+)
G776015 NA non-coding downstream 139140 16822631 ~ 16822832 (+)
G776016 NA non-coding downstream 139374 16822865 ~ 16823073 (+)
G776017 NA non-coding downstream 140647 16824138 ~ 16824345 (+)
LOC110532939 NA other upstream 340384 16315734 ~ 16342810 (+)
LOC110532936 LOC106577844 other upstream 432330 16233342 ~ 16250864 (+)
G775306 NA other upstream 495744 16186276 ~ 16187450 (+)
G775142 NA other upstream 816486 15866089 ~ 15866708 (+)
LOC110531590 LOC106577858 other upstream 1182118 15471215 ~ 15505643 (+)
LOC110532942 LOC106577806 other downstream 613564 17292470 ~ 17305629 (+)
G776487 NA other downstream 697134 17380625 ~ 17394121 (+)
G776818 LOC106600668 other downstream 974706 17658197 ~ 17659145 (+)
G777111 NA other downstream 1318398 18001889 ~ 18002182 (+)
G777113 NA other downstream 1319776 18003267 ~ 18005668 (+)

Expression


G775945 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G775945 Expression in each Bioproject

Bar chart with 8 bars.
G775945 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 30.
End of interactive chart.

Co-expression Network