G776286



Basic Information


Item Value
gene id G776286
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048573.1
NCBI id CM023227.2
chromosome length 79455637
location 16850302 ~ 16850610 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU884608
cagtcgtatattgcacaaatctggcctttatggaagagtggcaagaagaaagccatttcttaaagatatccataaaaagtgttgtttaaagtttgccacaagccacctgggagacacaccaaacatgtggaagaaggtgctctggtcagatgaaaccaaaattgaattttttggcaacaatgcaagacgttatgtttggcgtaaaagcaacacagctgaacgcaccatccccactgtcaaacatggtggtggcagcatcatggtttgggcctgcttttcttcagcagggacagggaagatggttaaaat

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU884608 True 309 lncRNA 0.43 1 16850302 16850610
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110531626 LOC106608856 coding downstream 21719 16827053 ~ 16828583 (-)
LOC110532940 LOC106608858 coding downstream 99008 16595063 ~ 16751294 (-)
LOC118966166 NA coding downstream 268497 16580259 ~ 16581805 (-)
LOC118966165 NA coding downstream 276410 16555795 ~ 16573892 (-)
LOC110531619 LOC100380775 coding downstream 410154 16427088 ~ 16440148 (-)
LOC110531628 cideb coding upstream 35918 16886528 ~ 16891710 (-)
LOC110531631 dhrs4 coding upstream 58228 16908838 ~ 16913948 (-)
LOC110531634 LOC106577795 coding upstream 103163 16953773 ~ 16966223 (-)
LOC110531636 LOC106577791 coding upstream 132100 16982710 ~ 17003093 (-)
LOC110531638 LOC106577815 coding upstream 177992 17028602 ~ 17043723 (-)
G776285 LOC107661334 non-coding downstream 1156 16848908 ~ 16849146 (-)
G776284 NA non-coding downstream 2620 16847408 ~ 16847682 (-)
G776282 NA non-coding downstream 7797 16842273 ~ 16842505 (-)
G776278 NA non-coding downstream 27673 16822282 ~ 16822629 (-)
G776277 NA non-coding downstream 28428 16821515 ~ 16821874 (-)
G776246 NA non-coding upstream 1698 16852308 ~ 16852628 (-)
G776288 NA non-coding upstream 3234 16853844 ~ 16854064 (-)
G776293 NA non-coding upstream 11760 16862370 ~ 16862675 (-)
G776295 NA non-coding upstream 15814 16866424 ~ 16866680 (-)
G776307 NA non-coding upstream 53811 16904421 ~ 16904688 (-)
G775532 NA other downstream 937008 15912836 ~ 15913294 (-)
G775139 NA other downstream 986468 15862320 ~ 15863834 (-)
LOC110531603 groa other downstream 1062696 15781909 ~ 15787666 (-)
G774954 NA other downstream 1224382 15625202 ~ 15625920 (-)
G776294 NA other upstream 14857 16865467 ~ 16866034 (-)
G776340 LOC106577790 other upstream 159402 17010012 ~ 17014685 (-)
G776355 NA other upstream 174770 17025380 ~ 17025813 (-)
G776461 NA other upstream 394824 17245434 ~ 17245797 (-)
G776652 NA other upstream 469005 17319615 ~ 17320373 (-)

Expression


G776286 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G776286 Expression in each Bioproject

Bar chart with 18 bars.
G776286 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network