G776295



Basic Information


Item Value
gene id G776295
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048573.1
NCBI id CM023227.2
chromosome length 79455637
location 16866424 ~ 16866680 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU884617
gggatatgtttcgtattgcgtcagataacaacattgacgaatacgctgatttggtgtgcgagttcattagaacgtgcgttgaagatgtcgttcccatagcaacgattaaaacattccctaaccagaaaccgtggattgatggcagcattcgcgtgaaactgaaagcgcgaaccactgcttttaatcagggcaaggtgactggtaacatgaccgaatacaaacagtgcagctattccctccgcaatgctatcaaacaa

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU884617 True 257 lncRNA 0.45 1 16866424 16866680

Neighbor


gene id symbol gene type direction distance location
LOC110531626 LOC106608856 coding downstream 37841 16827053 ~ 16828583 (-)
LOC110532940 LOC106608858 coding downstream 115130 16595063 ~ 16751294 (-)
LOC118966166 NA coding downstream 284619 16580259 ~ 16581805 (-)
LOC118966165 NA coding downstream 292532 16555795 ~ 16573892 (-)
LOC110531619 LOC100380775 coding downstream 426276 16427088 ~ 16440148 (-)
LOC110531628 cideb coding upstream 19848 16886528 ~ 16891710 (-)
LOC110531631 dhrs4 coding upstream 42158 16908838 ~ 16913948 (-)
LOC110531634 LOC106577795 coding upstream 87093 16953773 ~ 16966223 (-)
LOC110531636 LOC106577791 coding upstream 116030 16982710 ~ 17003093 (-)
LOC110531638 LOC106577815 coding upstream 161922 17028602 ~ 17043723 (-)
G776293 NA non-coding downstream 3749 16862370 ~ 16862675 (-)
G776288 NA non-coding downstream 12360 16853844 ~ 16854064 (-)
G776246 NA non-coding downstream 13796 16852308 ~ 16852628 (-)
G776286 NA non-coding downstream 15814 16850302 ~ 16850610 (-)
G776285 LOC107661334 non-coding downstream 17278 16848908 ~ 16849146 (-)
G776307 NA non-coding upstream 37741 16904421 ~ 16904688 (-)
G776310 NA non-coding upstream 56871 16923551 ~ 16925938 (-)
G776247 NA non-coding upstream 85726 16952406 ~ 16953579 (-)
G776329 NA non-coding upstream 104354 16971034 ~ 16971531 (-)
G776346 NA non-coding upstream 137116 17003796 ~ 17004079 (-)
G776294 NA other downstream 390 16865467 ~ 16866034 (-)
G775532 NA other downstream 953130 15912836 ~ 15913294 (-)
G775139 NA other downstream 1002590 15862320 ~ 15863834 (-)
LOC110531603 groa other downstream 1078818 15781909 ~ 15787666 (-)
G776340 LOC106577790 other upstream 143332 17010012 ~ 17014685 (-)
G776355 NA other upstream 158700 17025380 ~ 17025813 (-)
G776461 NA other upstream 378754 17245434 ~ 17245797 (-)
G776652 NA other upstream 452935 17319615 ~ 17320373 (-)
G776642 NA other upstream 478798 17345478 ~ 17354347 (-)

Expression


G776295 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G776295 Expression in each Bioproject

Bar chart with 10 bars.
G776295 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 35.
End of interactive chart.

Co-expression Network