G776606



Basic Information


Item Value
gene id G776606
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048573.1
NCBI id CM023227.2
chromosome length 79455637
location 17589621 ~ 17592646 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU884961
tctatggctgtctgaagtggttctcaatcagaggcaggtgtttatcgttgtctctgattgggaaccatatttaggcagccatattctttgagttggtcgtgggtgattgtccttagtgtcctgatgtcattgttctgtgttaggttacacaagtataggctgtttcggttttcgttaagtttattgttttgatagtgtttgtgtttagtgtgttacttcattaaacatggattgcaatagacac

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU884961 True 244 lncRNA 0.39 2 17589621 17592646

Neighbor


gene id symbol gene type direction distance location
LOC110531644 mettl3 coding upstream 243370 17339272 ~ 17346251 (+)
LOC110532942 LOC106577806 coding upstream 283992 17292470 ~ 17305629 (+)
LOC118966009 NA coding upstream 320587 17266030 ~ 17269034 (+)
LOC118966167 NA coding upstream 324204 17254266 ~ 17265417 (+)
LOC118966176 NA coding upstream 347071 17240870 ~ 17242550 (+)
LOC110531656 pop7 coding downstream 595092 18187738 ~ 18190442 (+)
LOC110531658 LOC106577765 coding downstream 658286 18250932 ~ 18256403 (+)
LOC110531660 LOC106608810 coding downstream 708722 18301368 ~ 18320759 (+)
LOC110531663 LOC106577697 coding downstream 1048009 18640655 ~ 18648675 (+)
LOC110531664 LOC106577696 coding downstream 1063531 18656177 ~ 18673318 (+)
G776598 NA non-coding upstream 16576 17572640 ~ 17573045 (+)
G776485 NA non-coding upstream 88660 17499303 ~ 17500961 (+)
G776555 NA non-coding upstream 99295 17489311 ~ 17490326 (+)
G776524 NA non-coding upstream 136999 17355232 ~ 17452622 (+)
G776611 NA non-coding downstream 7049 17599695 ~ 17600727 (+)
G776781 NA non-coding downstream 23642 17616288 ~ 17616818 (+)
G776790 NA non-coding downstream 30618 17623264 ~ 17623514 (+)
G776795 NA non-coding downstream 40469 17633115 ~ 17633330 (+)
G776804 NA non-coding downstream 48014 17640660 ~ 17640906 (+)
G776487 NA other upstream 195500 17380625 ~ 17394121 (+)
G775945 NA other upstream 906130 16683194 ~ 16683491 (+)
LOC110532939 NA other upstream 1246811 16315734 ~ 16342810 (+)
LOC110532936 LOC106577844 other upstream 1338757 16233342 ~ 16250864 (+)
G776818 LOC106600668 other downstream 65551 17658197 ~ 17659145 (+)
G777111 NA other downstream 409243 18001889 ~ 18002182 (+)
G777113 NA other downstream 410621 18003267 ~ 18005668 (+)
G777165 NA other downstream 515373 18108019 ~ 18108482 (+)
G777396 NA other downstream 906968 18499614 ~ 18500018 (+)

Expression


G776606 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G776606 Expression in each Bioproject

Bar chart with 9 bars.
G776606 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network