G778787



Basic Information


Item Value
gene id G778787
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048573.1
NCBI id CM023227.2
chromosome length 79455637
location 19277319 ~ 19278218 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU887367
accagttgcatattttagatcaccaggtgcacatttcaggtcaccaggtgcacatttcagatcaccaggtgcacggaggaaaatatttacttttgactttgacttttgacttcctatgacatcatattgcaaatggagaaaacatatgccttatgcacaagtaaaacaaaaagaaatatgtaatacaagttgaccaaggtatagtttgagcaaagtaaagtttgaattttgagcatgacaaattcgtgatggtacctgcccattaaaacatattgcaaatgcacagtgactttgaaaaagtaaggaaacataaacaaaaaaacatcccaaacattttttttggggttaccagttgcatattttagatcaccaggtgcacatttcaggtcaccaggtgcacatttcagatcaccaggtgcacggaggaaaatatttacttttgactttgacttttgacttcctatgacatcatattgcaaatggagaaaacatatgccttatgcacaagtaaaacaaaaataaatatgtaatacaagttgacaaaggtatagtt

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU887367 True 553 lncRNA 0.35 2 19277319 19278218
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110532954 LOC106577681 coding downstream 16235 19259903 ~ 19261084 (-)
LOC110531685 LOC106577724 coding downstream 27671 19247704 ~ 19249648 (-)
LOC110532953 LOC106577743 coding downstream 34477 19241127 ~ 19242842 (-)
LOC110531679 NA coding downstream 48633 19225697 ~ 19228686 (-)
LOC110531677 LOC106577725 coding downstream 72987 19201953 ~ 19204332 (-)
LOC110531676 nitr3 coding upstream 11816 19290034 ~ 19292357 (-)
LOC110532955 NA coding upstream 14539 19292757 ~ 19293496 (-)
LOC118966014 LOC106577677 coding upstream 31841 19310059 ~ 19310970 (-)
LOC110532957 LOC106577671 coding upstream 45514 19323732 ~ 19324732 (-)
LOC110531695 LOC106577660 coding upstream 584565 19862783 ~ 19868337 (-)
LOC110531690 NA non-coding downstream 80049 19196202 ~ 19197333 (-)
G778697 NA non-coding downstream 164392 19112661 ~ 19112927 (-)
G778696 NA non-coding downstream 165330 19111700 ~ 19111989 (-)
G778849 LOC106608711 non-coding upstream 120003 19398221 ~ 19442473 (-)
G778867 NA non-coding upstream 121355 19399573 ~ 19443353 (-)
G779050 NA non-coding upstream 313634 19591852 ~ 19592172 (-)
G779053 NA non-coding upstream 316820 19595038 ~ 19595451 (-)
G779055 NA non-coding upstream 317235 19595453 ~ 19595782 (-)
G778216 NA other downstream 919216 18355441 ~ 18358103 (-)
G776822 NA other downstream 1616836 17659690 ~ 17660483 (-)
G776820 NA other downstream 1617916 17659016 ~ 17659403 (-)
G776814 LOC106600668 other downstream 1620994 17655988 ~ 17656325 (-)
G776812 LOC106566110 other downstream 1621339 17655594 ~ 17655980 (-)
G780209 NA other upstream 539473 19817691 ~ 19824571 (-)
LOC110531704 LOC106608762 other upstream 793778 20022194 ~ 20075490 (-)
LOC110531717 LOC106577635 other upstream 1023860 20302051 ~ 20324316 (-)
LOC110531730 adgrl3 other upstream 1652742 20930960 ~ 21272646 (-)
G782003 NA other upstream 2497500 21775718 ~ 21776210 (-)

Expression


G778787 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G778787 Expression in each Bioproject

Bar chart with 15 bars.
G778787 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network