G780312



Basic Information


Item Value
gene id G780312
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048573.1
NCBI id CM023227.2
chromosome length 79455637
location 19965347 ~ 19965610 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU889055
GTGCTTGAATATCATATTTTCCAGAAAAATAACATTTGCTGGTGAAACTTAGACAATTTCACAGGTAATTTTGGAGGGTCAAAATCACATTTCATTAGGAATTCAAGTCCACCAAGTTTATTAAACAGACTGTTAGGGATATTAGACAGACATAATTTCAACCATTTAATTCTAAAAGCACCCACTAACAACTCAAACTCAATAGCCTGTAAACAAACCTCCATGATCATAGTCTTTCACTAATTGTGATTTCTGAATATAATG

Function


NR:

description
PREDICTED: uncharacterized protein LOC109200998

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU889055 True 264 lncRNA 0.32 1 19965347 19965610
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110531700 LOC106577652 coding downstream 4103 19949847 ~ 19961244 (-)
LOC110531696 LOC106577660 coding downstream 92891 19869438 ~ 19872456 (-)
LOC110531695 LOC106577660 coding downstream 97010 19862783 ~ 19868337 (-)
LOC110532957 LOC106577671 coding downstream 640615 19323732 ~ 19324732 (-)
LOC118966014 LOC106577677 coding downstream 654377 19310059 ~ 19310970 (-)
LOC110531702 LOC106577654 coding upstream 1359 19966969 ~ 19972714 (-)
LOC110531704 LOC106608762 coding upstream 56584 20022194 ~ 20075490 (-)
LOC110531705 LOC106577649 coding upstream 111147 20076757 ~ 20079422 (-)
LOC110531707 LOC106577647 coding upstream 122497 20088107 ~ 20103087 (-)
LOC110531708 LOC106577645 coding upstream 140530 20106140 ~ 20128782 (-)
G780295 NA non-coding downstream 24939 19940114 ~ 19940408 (-)
G780294 NA non-coding downstream 25304 19939821 ~ 19940043 (-)
G780277 NA non-coding downstream 26143 19935568 ~ 19939204 (-)
G780232 LOC106577661 non-coding downstream 112535 19851111 ~ 19852812 (-)
G780218 NA non-coding downstream 130862 19834253 ~ 19834485 (-)
G780322 NA non-coding upstream 14345 19979955 ~ 19980192 (-)
G780335 NA non-coding upstream 35405 20001015 ~ 20001246 (-)
G780339 NA non-coding upstream 39258 20004868 ~ 20005269 (-)
G780279 LOC106577651 non-coding upstream 50932 20016542 ~ 20025646 (-)
G780278 NA non-coding upstream 139215 20104825 ~ 20105899 (-)
G780209 NA other downstream 140776 19817691 ~ 19824571 (-)
G778216 NA other downstream 1607244 18355441 ~ 18358103 (-)
G776822 NA other downstream 2304864 17659690 ~ 17660483 (-)
G776820 NA other downstream 2305944 17659016 ~ 17659403 (-)
G776814 LOC106600668 other downstream 2309022 17655988 ~ 17656325 (-)
LOC110531717 LOC106577635 other upstream 336468 20302051 ~ 20324316 (-)
LOC110531730 adgrl3 other upstream 965350 20930960 ~ 21272646 (-)
G782003 NA other upstream 1810108 21775718 ~ 21776210 (-)
G784602 NA other upstream 3771611 23737221 ~ 23739513 (-)

Expression


G780312 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G780312 Expression in each Bioproject

Bar chart with 9 bars.
G780312 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 25.
End of interactive chart.

Co-expression Network