G781303



Basic Information


Item Value
gene id G781303
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048573.1
NCBI id CM023227.2
chromosome length 79455637
location 21393592 ~ 21393809 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU890108
gcggtgtgtcacagcatcatcggactgagcttgttgaaattgcaggcaatctcaacgctatgcgttacagggaagacatgctcctcccttatgtggtacccttcctgcaggctcatcctgacatgaccctccagcatgacaatgccaccagccatactgcttgttctgtgtgtgatttcctgcaagacaggaatgtcagtgttctgccatggccagag

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU890108 True 218 lncRNA 0.52 1 21393592 21393809

Neighbor


gene id symbol gene type direction distance location
LOC110531730 adgrl3 coding downstream 120946 20930960 ~ 21272646 (-)
LOC110531729 LOC106577627 coding downstream 532827 20633242 ~ 20860765 (-)
sst5 LOC106577629 coding downstream 838581 20550368 ~ 20555011 (-)
bcl6b LOC106577630 coding downstream 870815 20508426 ~ 20522777 (-)
slc16a13 slc16a13 coding downstream 887933 20461795 ~ 20505659 (-)
LOC110531734 LOC106577624 coding upstream 12120 21405929 ~ 21414442 (-)
LOC110531735 tyrp-1 coding upstream 21398 21415207 ~ 21428695 (-)
LOC110531744 LOC106577622 coding upstream 1169168 22562977 ~ 22627895 (-)
LOC110531745 LOC106577621 coding upstream 1259304 22653113 ~ 22662757 (-)
LOC110531750 LOC106577620 coding upstream 1277646 22671455 ~ 22674494 (-)
G781293 NA non-coding downstream 8477 21384774 ~ 21385115 (-)
G781288 NA non-coding downstream 20952 21372416 ~ 21372640 (-)
G781147 NA non-coding downstream 27262 21366039 ~ 21366330 (-)
G781140 NA non-coding downstream 35068 21358301 ~ 21358524 (-)
G781139 NA non-coding downstream 35599 21357075 ~ 21357993 (-)
G781305 NA non-coding upstream 5073 21398882 ~ 21399117 (-)
G781306 NA non-coding upstream 7962 21401771 ~ 21401978 (-)
G781308 NA non-coding upstream 9896 21403705 ~ 21404100 (-)
G781286 NA non-coding upstream 10886 21404695 ~ 21495894 (-)
G781412 NA non-coding upstream 163185 21556994 ~ 21557218 (-)
LOC110531717 LOC106577635 other downstream 1090212 20302051 ~ 20324316 (-)
LOC110531704 LOC106608762 other downstream 1318140 20022194 ~ 20075490 (-)
G780209 NA other downstream 1569021 19817691 ~ 19824571 (-)
G778216 NA other downstream 3035489 18355441 ~ 18358103 (-)
G782003 NA other upstream 381909 21775718 ~ 21776210 (-)
G784602 NA other upstream 2343412 23737221 ~ 23739513 (-)
G784652 NA other upstream 2406974 23800783 ~ 23801684 (-)
G784651 NA other upstream 2412749 23806558 ~ 23808272 (-)
frem1a frem1 other upstream 2451466 23845242 ~ 23876940 (-)

Expression


G781303 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

G781303 Expression in each Bioproject

Bar chart with 19 bars.
G781303 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 750.
End of interactive chart.

Co-expression Network