G781286



Basic Information


Item Value
gene id G781286
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048573.1
NCBI id CM023227.2
chromosome length 79455637
location 21404695 ~ 21495894 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU890091
TTTTTTCTTTTCAAGTCTCTCTTTAAATACTGACTCAGCTAAACATCGTCTTGGTTGCTCATGTAAACAATGCAAAGACAGAGGGCTTTCTTTGACACAGAGTGGGGCGTGGCAGTTTATATCCAGTTTGTTAATTAAGTGTAAACCTTCAGCAGAGGCACGCCAACCCAATGAATCACAAGGGACATATGCCCCTTCTATTTGAGCAAAACTTGATGTGAACAGAAAAGTTGATGTCAAAGAAAGGCATATCTTACTTGGTATATTGTGTTTGTGTAAAAAGGCCTGTAGGATATAAAATATTGTTTTAAAGATTGTAAACACAGAATGAATTTATATTTCAAGAAAGTCAGTACTGAATATGGTTTATAAAGGCTTCCTTAATAAATTCCCCTCGAACCTTGAGCTAAGAACGACTGACAAGTGCAGAACCTTTTTTCTTGGCACCTCTGCTCTGTAATCTTGAGTATTTGGTTCTATCAATAATGTGTTATTCAGCTCAAACTGTAGGCCA

Function


GO: NA

KEGG:

id description

RNA


RNA id representative length rna type GC content exon number start site end site
TU890091 True 514 lncRNA 0.37 2 21404695 21495894
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110531730 adgrl3 coding downstream 132049 20930960 ~ 21272646 (-)
LOC110531729 LOC106577627 coding downstream 543930 20633242 ~ 20860765 (-)
sst5 LOC106577629 coding downstream 849684 20550368 ~ 20555011 (-)
bcl6b LOC106577630 coding downstream 881918 20508426 ~ 20522777 (-)
slc16a13 slc16a13 coding downstream 899036 20461795 ~ 20505659 (-)
LOC110531744 LOC106577622 coding upstream 1067083 22562977 ~ 22627895 (-)
LOC110531745 LOC106577621 coding upstream 1157219 22653113 ~ 22662757 (-)
LOC110531750 LOC106577620 coding upstream 1175561 22671455 ~ 22674494 (-)
LOC110531746 LOC106577618 coding upstream 1185199 22681093 ~ 22726529 (-)
kcnip4 LOC106577616 coding upstream 1271836 22767730 ~ 23033993 (-)
G781308 NA non-coding downstream 595 21403705 ~ 21404100 (-)
G781306 NA non-coding downstream 2717 21401771 ~ 21401978 (-)
G781305 NA non-coding downstream 5578 21398882 ~ 21399117 (-)
G781303 NA non-coding downstream 10886 21393592 ~ 21393809 (-)
G781293 NA non-coding downstream 19580 21384774 ~ 21385115 (-)
G781412 NA non-coding upstream 61100 21556994 ~ 21557218 (-)
G781860 NA non-coding upstream 80875 21576769 ~ 21577307 (-)
G781864 NA non-coding upstream 90207 21586101 ~ 21586377 (-)
G782185 LOC106577623 non-coding upstream 580094 22075988 ~ 22081146 (-)
G782288 NA non-coding upstream 729097 22224991 ~ 22225191 (-)
LOC110531717 LOC106577635 other downstream 1101315 20302051 ~ 20324316 (-)
LOC110531704 LOC106608762 other downstream 1329243 20022194 ~ 20075490 (-)
G780209 NA other downstream 1580124 19817691 ~ 19824571 (-)
G778216 NA other downstream 3046592 18355441 ~ 18358103 (-)
G782003 NA other upstream 279824 21775718 ~ 21776210 (-)
G784602 NA other upstream 2241327 23737221 ~ 23739513 (-)
G784652 NA other upstream 2304889 23800783 ~ 23801684 (-)
G784651 NA other upstream 2310664 23806558 ~ 23808272 (-)
frem1a frem1 other upstream 2349381 23845242 ~ 23876940 (-)

Expression


G781286 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G781286 Expression in each Bioproject

Bar chart with 17 bars.
G781286 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network