G781412



Basic Information


Item Value
gene id G781412
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048573.1
NCBI id CM023227.2
chromosome length 79455637
location 21556994 ~ 21557218 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU890221
ggtcactatagcaacacccacccatagcacgcgctccagcaggtatatttcactggtcatccccaaagcaaacacctactttggtcacctttccttccagttctctgctgccaatgactggaactaattgcaaaaatcactgaagctgaagacttatatctccctcactaactttaagcatcagctgtcagagcagcttaccgatcaatgcacctgtacacagcc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU890221 True 225 lncRNA 0.47 1 21556994 21557218
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110531735 tyrp-1 coding downstream 128299 21415207 ~ 21428695 (-)
LOC110531734 LOC106577624 coding downstream 142552 21405929 ~ 21414442 (-)
LOC110531730 adgrl3 coding downstream 284348 20930960 ~ 21272646 (-)
LOC110531729 LOC106577627 coding downstream 696229 20633242 ~ 20860765 (-)
sst5 LOC106577629 coding downstream 1001983 20550368 ~ 20555011 (-)
LOC110531744 LOC106577622 coding upstream 1005759 22562977 ~ 22627895 (-)
LOC110531745 LOC106577621 coding upstream 1095895 22653113 ~ 22662757 (-)
LOC110531750 LOC106577620 coding upstream 1114237 22671455 ~ 22674494 (-)
LOC110531746 LOC106577618 coding upstream 1123875 22681093 ~ 22726529 (-)
kcnip4 LOC106577616 coding upstream 1210512 22767730 ~ 23033993 (-)
G781286 NA non-coding downstream 61100 21404695 ~ 21495894 (-)
G781308 NA non-coding downstream 152894 21403705 ~ 21404100 (-)
G781306 NA non-coding downstream 155016 21401771 ~ 21401978 (-)
G781305 NA non-coding downstream 157877 21398882 ~ 21399117 (-)
G781303 NA non-coding downstream 163185 21393592 ~ 21393809 (-)
G781860 NA non-coding upstream 19551 21576769 ~ 21577307 (-)
G781864 NA non-coding upstream 28883 21586101 ~ 21586377 (-)
G782185 LOC106577623 non-coding upstream 518770 22075988 ~ 22081146 (-)
G782288 NA non-coding upstream 667773 22224991 ~ 22225191 (-)
G782333 NA non-coding upstream 696873 22254091 ~ 22254305 (-)
LOC110531717 LOC106577635 other downstream 1253614 20302051 ~ 20324316 (-)
LOC110531704 LOC106608762 other downstream 1481542 20022194 ~ 20075490 (-)
G780209 NA other downstream 1732423 19817691 ~ 19824571 (-)
G778216 NA other downstream 3198891 18355441 ~ 18358103 (-)
G782003 NA other upstream 218500 21775718 ~ 21776210 (-)
G784602 NA other upstream 2180003 23737221 ~ 23739513 (-)
G784652 NA other upstream 2243565 23800783 ~ 23801684 (-)
G784651 NA other upstream 2249340 23806558 ~ 23808272 (-)
frem1a frem1 other upstream 2288057 23845242 ~ 23876940 (-)

Expression


G781412 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G781412 Expression in each Bioproject

Bar chart with 18 bars.
G781412 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network