G782003



Basic Information


Item Value
gene id G782003
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048573.1
NCBI id CM023227.2
chromosome length 79455637
location 21775718 ~ 21776210 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU890849
gagctatatacagggagtaccagtaccaggtcaatgtggagctatatacagggagtaccagtaccaggtcaatgtggagctatatacagggagtaccagtaccaggtcaatgtggagctatatacagggagtaccagtaccagatcaatgtggagctatatacagcgagtaccagtaccagatcaatgtggagctatatacagggagtaccagtaccagatcaatgtggagctatatacagggagtaccagtaccagatcaatgtggagctatatacagggagtaccagtaccagatcaatgtggagctatatacagggagtaccagtaccagatcaatgt

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU890849 True 341 TUCP 0.45 2 21775718 21776210
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110531735 tyrp-1 coding downstream 347023 21415207 ~ 21428695 (-)
LOC110531734 LOC106577624 coding downstream 361276 21405929 ~ 21414442 (-)
LOC110531730 adgrl3 coding downstream 503072 20930960 ~ 21272646 (-)
LOC110531729 LOC106577627 coding downstream 914953 20633242 ~ 20860765 (-)
sst5 LOC106577629 coding downstream 1220707 20550368 ~ 20555011 (-)
LOC110531744 LOC106577622 coding upstream 786767 22562977 ~ 22627895 (-)
LOC110531745 LOC106577621 coding upstream 876903 22653113 ~ 22662757 (-)
LOC110531750 LOC106577620 coding upstream 895245 22671455 ~ 22674494 (-)
LOC110531746 LOC106577618 coding upstream 904883 22681093 ~ 22726529 (-)
kcnip4 LOC106577616 coding upstream 991520 22767730 ~ 23033993 (-)
G781864 NA non-coding downstream 189341 21586101 ~ 21586377 (-)
G781860 NA non-coding downstream 198411 21576769 ~ 21577307 (-)
G781412 NA non-coding downstream 218500 21556994 ~ 21557218 (-)
G781286 NA non-coding downstream 279824 21404695 ~ 21495894 (-)
G781308 NA non-coding downstream 371618 21403705 ~ 21404100 (-)
G782185 LOC106577623 non-coding upstream 299778 22075988 ~ 22081146 (-)
G782288 NA non-coding upstream 448781 22224991 ~ 22225191 (-)
G782333 NA non-coding upstream 477881 22254091 ~ 22254305 (-)
G782396 NA non-coding upstream 519234 22295444 ~ 22295644 (-)
G782397 NA non-coding upstream 520879 22297089 ~ 22297290 (-)
LOC110531717 LOC106577635 other downstream 1472338 20302051 ~ 20324316 (-)
LOC110531704 LOC106608762 other downstream 1700266 20022194 ~ 20075490 (-)
G780209 NA other downstream 1951147 19817691 ~ 19824571 (-)
G778216 NA other downstream 3417615 18355441 ~ 18358103 (-)
G784602 NA other upstream 1961011 23737221 ~ 23739513 (-)
G784652 NA other upstream 2024573 23800783 ~ 23801684 (-)
G784651 NA other upstream 2030348 23806558 ~ 23808272 (-)
frem1a frem1 other upstream 2069065 23845242 ~ 23876940 (-)
LOC110531775 LOC107706756 other upstream 2430243 24206453 ~ 24208980 (-)

Expression


G782003 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

G782003 Expression in each Bioproject

Bar chart with 18 bars.
G782003 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1000.
End of interactive chart.

Co-expression Network