G782288



Basic Information


Item Value
gene id G782288
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048573.1
NCBI id CM023227.2
chromosome length 79455637
location 22224991 ~ 22225191 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU891144
ACCACATATTTCCCACCCAAGAAAGTAGGCAAAGACAATTTCCTTTACGGCACAATTCACTTTATACACACTTGCTGGGACGGAAATTGCAGTCCATTAAAATCTCCTGTTAAATATGAATTGCGGCAGTTTATGCTCATTGTGTTTCCGATACAGGTTGTTATTGTGTTTGGACTAGTTAGTAACAAACGAAAAGTATAT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU891144 True 201 lncRNA 0.37 1 22224991 22225191
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110531735 tyrp-1 coding downstream 796296 21415207 ~ 21428695 (-)
LOC110531734 LOC106577624 coding downstream 810549 21405929 ~ 21414442 (-)
LOC110531730 adgrl3 coding downstream 952345 20930960 ~ 21272646 (-)
LOC110531729 LOC106577627 coding downstream 1364226 20633242 ~ 20860765 (-)
sst5 LOC106577629 coding downstream 1669980 20550368 ~ 20555011 (-)
LOC110531744 LOC106577622 coding upstream 337786 22562977 ~ 22627895 (-)
LOC110531745 LOC106577621 coding upstream 427922 22653113 ~ 22662757 (-)
LOC110531750 LOC106577620 coding upstream 446264 22671455 ~ 22674494 (-)
LOC110531746 LOC106577618 coding upstream 455902 22681093 ~ 22726529 (-)
kcnip4 LOC106577616 coding upstream 542539 22767730 ~ 23033993 (-)
G782185 LOC106577623 non-coding downstream 143845 22075988 ~ 22081146 (-)
G781864 NA non-coding downstream 638614 21586101 ~ 21586377 (-)
G781860 NA non-coding downstream 647684 21576769 ~ 21577307 (-)
G781412 NA non-coding downstream 667773 21556994 ~ 21557218 (-)
G781286 NA non-coding downstream 729097 21404695 ~ 21495894 (-)
G782333 NA non-coding upstream 28900 22254091 ~ 22254305 (-)
G782396 NA non-coding upstream 70253 22295444 ~ 22295644 (-)
G782397 NA non-coding upstream 71898 22297089 ~ 22297290 (-)
G782427 NA non-coding upstream 91249 22316440 ~ 22316719 (-)
G782444 NA non-coding upstream 106637 22331828 ~ 22332156 (-)
G782003 NA other downstream 448781 21775718 ~ 21776210 (-)
LOC110531717 LOC106577635 other downstream 1921611 20302051 ~ 20324316 (-)
LOC110531704 LOC106608762 other downstream 2149539 20022194 ~ 20075490 (-)
G780209 NA other downstream 2400420 19817691 ~ 19824571 (-)
G784602 NA other upstream 1512030 23737221 ~ 23739513 (-)
G784652 NA other upstream 1575592 23800783 ~ 23801684 (-)
G784651 NA other upstream 1581367 23806558 ~ 23808272 (-)
frem1a frem1 other upstream 1620084 23845242 ~ 23876940 (-)
LOC110531775 LOC107706756 other upstream 1981262 24206453 ~ 24208980 (-)

Expression


G782288 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G782288 Expression in each Bioproject

Bar chart with 1 bar.
G782288 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Co-expression Network