G789228 (LOC106577504)



Basic Information


Item Value
gene id G789228
gene name LOC106577504
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048573.1
NCBI id CM023227.2
chromosome length 79455637
location 28145220 ~ 28146979 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU898702
TTATGTCGTCAACTTCCGAAGTCCCTGAAATCACTGATTCAGGTGATGATGATCTATATCCATATACAGAAGATGTAACACATTCAGGTATTGCATGTCTGAACTCAGGTATGGGTGAGTCAGGTGACAGCGCCCTGTATTCATCTATAGATGCTATTGAATCAGGTGATGAGGGTCTAATCTCAAAAAGCATTGAGGTATGTAAGAATAAGTCAGTTTCAGATTCCATATCTGAGCATATTGATTCAGGCGATGCTGATCTATTCCCTGCCACTAGTGTAGTAGTTTCGTGCTGTGTGTACTGGGGTACTGGGGAGTCTGGT

Function


NR:

description
uncharacterized protein LOC110532981

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU898702 True 323 TUCP 0.42 2 28145220 28146979
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110531868 LOC106577509 coding downstream 248382 27894036 ~ 27896838 (-)
chi chi coding downstream 272849 27867348 ~ 27872371 (-)
LOC100136672 sstr1b coding downstream 310806 27821574 ~ 27834414 (-)
LOC110531864 LOC106577516 coding downstream 521390 27601045 ~ 27623830 (-)
trnaa-ugc-33 NA coding downstream 660779 27484368 ~ 27484441 (-)
camk2d1 LOC106577507 coding upstream 16689 28163668 ~ 28283460 (-)
LOC110531871 LOC106577503 coding upstream 147196 28294175 ~ 28310607 (-)
LOC110531873 LOC106577501 coding upstream 195160 28342139 ~ 28432006 (-)
LOC110531875 zcchc4 coding upstream 289562 28436541 ~ 28443621 (-)
LOC110531879 LOC106577493 coding upstream 520260 28667239 ~ 28993223 (-)
G789131 NA non-coding downstream 80625 27995891 ~ 28064595 (-)
G789009 NA non-coding downstream 313258 27827524 ~ 27831962 (-)
G788738 NA non-coding downstream 338058 27806958 ~ 27807162 (-)
G788724 NA non-coding downstream 352103 27792791 ~ 27793117 (-)
G788715 NA non-coding downstream 362800 27782010 ~ 27782420 (-)
G789268 NA non-coding upstream 118809 28265788 ~ 28266250 (-)
G789397 NA non-coding upstream 167848 28314827 ~ 28315047 (-)
G789403 NA non-coding upstream 180880 28327859 ~ 28328172 (-)
G789433 NA non-coding upstream 233400 28380379 ~ 28381404 (-)
G788495 NA other downstream 581695 27563162 ~ 27563525 (-)
G788408 LOC106577523 other downstream 676898 27463292 ~ 27468322 (-)
LOC110531854 LOC106577527 other downstream 763931 27376312 ~ 27381485 (-)
G788173 NA other downstream 1208456 26936484 ~ 26936764 (-)
G789863 LOC100194703 other upstream 381841 28528820 ~ 28652471 (-)
G789945 NA other upstream 516472 28663451 ~ 28666058 (-)
LOC110531881 LOC106577491 other upstream 896457 29042575 ~ 29045196 (-)
G790535 NA other upstream 901919 29048898 ~ 29049244 (-)
G790551 NA other upstream 921873 29068852 ~ 29069187 (-)

Expression


G789228(LOC106577504) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 150.
End of interactive chart.

G789228(LOC106577504) Expression in each Bioproject

Bar chart with 8 bars.
G789228(LOC106577504) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 250.
End of interactive chart.

Co-expression Network