G790598



Basic Information


Item Value
gene id G790598
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048573.1
NCBI id CM023227.2
chromosome length 79455637
location 29131374 ~ 29149017 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU900193
agatggatggagccaaatacaggaccattctggaagaacctgatggagtctgcaaaagacctgagactgggacagagatttgtcttccaacaagacaatgatccaaaacataaagcaaaatctacaatggaatggttcaaaaataaacatatccaggtgttagaatggccaagtcaaagtccagacccgaatctgtggaaagaactgaaaactgctgttcacaaatgctctccatccaacctcactgagctcgagctgttttgcaaggaggaatgggaaaacatttcagtctctcgatgtgcaaaactgatagagacataccccaagcgacttacagctgtaatcgcagcaaaaggtggcgct

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU900193 True 363 TUCP 0.44 2 29131374 29149017
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110531881 LOC106577491 coding downstream 86178 29042575 ~ 29045196 (-)
LOC110531879 LOC106577493 coding downstream 138151 28667239 ~ 28993223 (-)
LOC110531880 NA coding downstream 164418 28964444 ~ 28966956 (-)
LOC110531875 zcchc4 coding downstream 687753 28436541 ~ 28443621 (-)
LOC110531873 LOC106577501 coding downstream 699368 28342139 ~ 28432006 (-)
LOC110531887 LOC106577486 coding upstream 195364 29344381 ~ 29353599 (-)
LOC110532982 NA coding upstream 1210790 30359807 ~ 30360792 (-)
LOC118965933 NA coding upstream 1683709 30832726 ~ 30834388 (-)
LOC118965934 LOC106595224 coding upstream 1889061 31038078 ~ 31040215 (-)
LOC110531151 NA coding upstream 2220466 31369483 ~ 31494494 (-)
G790556 NA non-coding downstream 53340 29077824 ~ 29078034 (-)
LOC110531883 LOC106577489 non-coding downstream 60113 29070047 ~ 29139723 (-)
G790542 NA non-coding downstream 73458 29057637 ~ 29057916 (-)
G790541 NA non-coding downstream 73793 29057348 ~ 29057581 (-)
G790539 NA non-coding downstream 76098 29055050 ~ 29055276 (-)
G790716 LOC106577485 non-coding upstream 176499 29325516 ~ 29328373 (-)
G790724 LOC106602727 non-coding upstream 183273 29332290 ~ 29332787 (-)
G790731 NA non-coding upstream 188749 29337766 ~ 29339792 (-)
G790732 NA non-coding upstream 190866 29339883 ~ 29342202 (-)
G790762 NA non-coding upstream 234238 29383255 ~ 29383467 (-)
G790551 NA other downstream 62187 29068852 ~ 29069187 (-)
G790535 NA other downstream 82130 29048898 ~ 29049244 (-)
G789945 NA other downstream 465316 28663451 ~ 28666058 (-)
G789863 LOC100194703 other downstream 478903 28528820 ~ 28652471 (-)
G792267 NA other upstream 1166293 30315310 ~ 30357964 (-)
G793472 NA other upstream 2254465 31403482 ~ 31403869 (-)
G793489 NA other upstream 2269438 31418455 ~ 31418973 (-)
G793842 NA other upstream 2512222 31661239 ~ 31662198 (-)
G794311 LOC106577443 other upstream 2877054 32026071 ~ 32028445 (-)

Expression


G790598 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G790598 Expression in each Bioproject

Bar chart with 20 bars.
G790598 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network