G790716 (LOC106577485)



Basic Information


Item Value
gene id G790716
gene name LOC106577485
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048573.1
NCBI id CM023227.2
chromosome length 79455637
location 29325516 ~ 29328373 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU900314
GTGGATGTAGAAGGCACCCCATTGCTGGGAGCTGGCATGAAAGTTTCCCCCCTCCACATGTAGGTAGCGCGTGCTGACCGTCTGGGACCGCAACCGGTTGAACAGGGCCACCTTGGTCCCCGATGCAATACACACTGGATCTGCATTCTTCAGGGACTGCTTCTTTTTGGAGGGCTTGGAGATTACTTTGATTCTCTTGCTGAGGAAGACGCCAATGTCTGTGCTGTTGCCGTAAAACATCTTGACGGACAGCATGAAGTGCTTTCTCTTGTCGGAGTCTGATATGTACAAGGTTTTGGCTGTGCAAT

Function


NR:

description
PREDICTED: recombining binding protein suppressor of hairless isoform X1

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU900314 True 308 lncRNA 0.52 2 29325516 29328373

Neighbor


gene id symbol gene type direction distance location
LOC110531884 LOC106577488 coding downstream 150928 29140350 ~ 29174588 (-)
LOC110531883 LOC106577489 coding downstream 185793 29070047 ~ 29139723 (-)
LOC110531881 LOC106577491 coding downstream 280320 29042575 ~ 29045196 (-)
LOC110531879 LOC106577493 coding downstream 332293 28667239 ~ 28993223 (-)
LOC110531880 NA coding downstream 358560 28964444 ~ 28966956 (-)
LOC110531887 LOC106577486 coding upstream 16008 29344381 ~ 29353599 (-)
LOC110532982 NA coding upstream 1031434 30359807 ~ 30360792 (-)
LOC118965933 NA coding upstream 1504353 30832726 ~ 30834388 (-)
LOC118965934 LOC106595224 coding upstream 1709705 31038078 ~ 31040215 (-)
LOC110531151 NA coding upstream 2041110 31369483 ~ 31494494 (-)
G790573 NA non-coding downstream 189076 29104062 ~ 29136440 (-)
G790556 NA non-coding downstream 247482 29077824 ~ 29078034 (-)
G790542 NA non-coding downstream 267600 29057637 ~ 29057916 (-)
G790541 NA non-coding downstream 267935 29057348 ~ 29057581 (-)
G790724 LOC106602727 non-coding upstream 3917 29332290 ~ 29332787 (-)
G790731 NA non-coding upstream 9393 29337766 ~ 29339792 (-)
G790732 NA non-coding upstream 11510 29339883 ~ 29342202 (-)
G790762 NA non-coding upstream 54882 29383255 ~ 29383467 (-)
G790852 NA non-coding upstream 187339 29515712 ~ 29527428 (-)
G790598 NA other downstream 176499 29131374 ~ 29149017 (-)
G790551 NA other downstream 256329 29068852 ~ 29069187 (-)
G790535 NA other downstream 276272 29048898 ~ 29049244 (-)
G789945 NA other downstream 659458 28663451 ~ 28666058 (-)
G792267 NA other upstream 986937 30315310 ~ 30357964 (-)
G793472 NA other upstream 2075109 31403482 ~ 31403869 (-)
G793489 NA other upstream 2090082 31418455 ~ 31418973 (-)
G793842 NA other upstream 2332866 31661239 ~ 31662198 (-)
G794311 LOC106577443 other upstream 2697698 32026071 ~ 32028445 (-)

Expression


G790716(LOC106577485) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 0.4.
End of interactive chart.

G790716(LOC106577485) Expression in each Bioproject

Bar chart with 4 bars.
G790716(LOC106577485) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 2.
End of interactive chart.

Co-expression Network