G792905


Basic Information

Item Value
gene id G792905
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048573.1
NCBI id CM023227.2
chromosome length 79455637
location 30933129 ~ 31023128 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU902581
gcgctctcccgacagagttacctctcgttccagtgcttttcttcagacaggaattctccggttggaagcttattgatgttttatgttaacctctagcgtcgagcaatcccgtatccaggagcgtaatcatagcctcaagctcattaccataacgcaacgttaactattcatgaaaatcgcaaatgaaatgaaataaatatgccatctctcaagcttagccttttgtaaacaacactgtcatctcagattttcaaaatatgcttctcaaccataggaaaacaatcatttgtgtaaaagtagctagctagcgtagcatttagcgttagcattagcgttagcatccagcacgcaacattaacaaaaacataaaagccttcaaataaaatcatttacctttgaagaacttctgatgttttcaatgaggatactctcagttagatagcagatgctcagtttttccaaaaagattctttgtgtattagaaatagctccgttttgtacatcacatttggctaccaaaaaaccccgaaaattcagtcctcaaaacgcgaacttttttccaaattaactccataatatcgactgaaaacatggcaaacgttgtttagaatcaatcctcaaggtgtttttcacatatctcttcgatgatatatcgttcgtggaagcatggtttcccctctcaatcaaatggaaaaatacttgcacatggctttacgcaccagtttcgacgcaggacaccaggcggacacttggaaaatgtagtctcttatggtcaatctt

Function

NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU902581 True 780 lncRNA 0.39 3 30933129 31023128
Loading

Neighbor

gene id symbol gene type direction distance location
LOC118965933 NA coding downstream 98741 30832726 ~ 30834388 (-)
LOC110532982 NA coding downstream 572337 30359807 ~ 30360792 (-)
LOC110531887 LOC106577486 coding downstream 1579530 29344381 ~ 29353599 (-)
LOC110531884 LOC106577488 coding downstream 1758541 29140350 ~ 29174588 (-)
LOC110531883 LOC106577489 coding downstream 1793406 29070047 ~ 29139723 (-)
LOC118965934 LOC106595224 coding upstream 14950 31038078 ~ 31040215 (-)
LOC110531151 NA coding upstream 346355 31369483 ~ 31494494 (-)
LOC110531916 NA coding upstream 749839 31772967 ~ 31780212 (-)
LOC110531919 LOC106577449 coding upstream 1070066 32093194 ~ 32102718 (-)
slx1b LOC106577450 coding upstream 1091176 32114304 ~ 32122169 (-)
G792799 NA non-coding downstream 2349 30930560 ~ 30930780 (-)
G792749 NA non-coding downstream 36592 30896314 ~ 30896537 (-)
G792747 NA non-coding downstream 37016 30895890 ~ 30896113 (-)
G792745 NA non-coding downstream 37864 30895027 ~ 30895265 (-)
G792555 NA non-coding downstream 209486 30713151 ~ 30723643 (-)
G793007 NA non-coding upstream 58015 31081143 ~ 31081570 (-)
G793279 NA non-coding upstream 246309 31269437 ~ 31269835 (-)
G793305 NA non-coding upstream 262199 31285327 ~ 31285544 (-)
G793334 NA non-coding upstream 278977 31302105 ~ 31302869 (-)
G793349 NA non-coding upstream 288060 31311188 ~ 31311418 (-)
G792267 NA other downstream 575165 30315310 ~ 30357964 (-)
G790598 NA other downstream 1784112 29131374 ~ 29149017 (-)
G790551 NA other downstream 1863942 29068852 ~ 29069187 (-)
G790535 NA other downstream 1883885 29048898 ~ 29049244 (-)
LOC110531881 LOC106577491 other downstream 1889322 29042575 ~ 29045196 (-)
G793472 NA other upstream 380354 31403482 ~ 31403869 (-)
G793489 NA other upstream 395327 31418455 ~ 31418973 (-)
G793842 NA other upstream 638111 31661239 ~ 31662198 (-)
G794311 LOC106577443 other upstream 1002943 32026071 ~ 32028445 (-)
G796733 rl32 other upstream 3027931 34051059 ~ 34057549 (-)

Expression

G792905 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G792905 Expression in each Bioproject

Bar chart with 18 bars.
G792905 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network