G793472



Basic Information


Item Value
gene id G793472
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048573.1
NCBI id CM023227.2
chromosome length 79455637
location 31403482 ~ 31403869 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU903165
ggttcaaattgatgggaagatggatggagccaaatacaggaccattctggaagaaaacctgatggagtctgcaaaagacctgagactgggacggagatttgtcttccaacaagacaatgatccaaaacataaagccaaatctacaatggaatggttcaaaaataaacatatccaggtgttagaatggtcaagtcaaagtccagacctgaatccaatcgagaatctgtggaaagaactgaaaactgctgttcacaaatgctctccatccaacctcactgagctcgagctgttttgcaaggaggaatgggaaaaaacttcagtctctcgatgtgcaaaactgatagagacataccccaagcgacttacagctgtaatcgcagcaaaaggt

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU903165 True 388 TUCP 0.43 1 31403482 31403869

Neighbor


gene id symbol gene type direction distance location
LOC118965934 LOC106595224 coding downstream 363267 31038078 ~ 31040215 (-)
LOC118965933 NA coding downstream 569094 30832726 ~ 30834388 (-)
LOC110532982 NA coding downstream 1042690 30359807 ~ 30360792 (-)
LOC110531887 LOC106577486 coding downstream 2049883 29344381 ~ 29353599 (-)
LOC110531884 LOC106577488 coding downstream 2228894 29140350 ~ 29174588 (-)
LOC110531916 NA coding upstream 369098 31772967 ~ 31780212 (-)
LOC110531919 LOC106577449 coding upstream 689325 32093194 ~ 32102718 (-)
slx1b LOC106577450 coding upstream 710435 32114304 ~ 32122169 (-)
LOC110531923 LOC106577454 coding upstream 774410 32178279 ~ 32201170 (-)
LOC110531924 LOC106577455 coding upstream 813274 32217143 ~ 32220999 (-)
G793463 NA non-coding downstream 4060 31399154 ~ 31399422 (-)
G793455 NA non-coding downstream 11070 31391971 ~ 31392412 (-)
G793453 NA non-coding downstream 12017 31391192 ~ 31391465 (-)
G793390 NA non-coding downstream 55044 31348023 ~ 31348438 (-)
G793349 NA non-coding downstream 92064 31311188 ~ 31311418 (-)
G793480 NA non-coding upstream 6740 31410609 ~ 31411030 (-)
G793482 NA non-coding upstream 7242 31411111 ~ 31411363 (-)
G793491 NA non-coding upstream 15298 31419167 ~ 31419584 (-)
G793498 NA non-coding upstream 19047 31422916 ~ 31423138 (-)
G793507 NA non-coding upstream 25433 31429302 ~ 31429561 (-)
G792267 NA other downstream 1045518 30315310 ~ 30357964 (-)
G790598 NA other downstream 2254465 29131374 ~ 29149017 (-)
G790551 NA other downstream 2334295 29068852 ~ 29069187 (-)
G790535 NA other downstream 2354238 29048898 ~ 29049244 (-)
LOC110531881 LOC106577491 other downstream 2359675 29042575 ~ 29045196 (-)
G793489 NA other upstream 14586 31418455 ~ 31418973 (-)
G793842 NA other upstream 257370 31661239 ~ 31662198 (-)
G794311 LOC106577443 other upstream 622202 32026071 ~ 32028445 (-)
G796733 rl32 other upstream 2647190 34051059 ~ 34057549 (-)
G797605 NA other upstream 3466086 34869955 ~ 34875879 (-)

Expression


G793472 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G793472 Expression in each Bioproject

Bar chart with 20 bars.
G793472 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network