G794141



Basic Information


Item Value
gene id G794141
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048573.1
NCBI id CM023227.2
chromosome length 79455637
location 31897388 ~ 31897611 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU903875
tccctgtccctgctgaagaaaagcaggcccaaactatgatgctgccaccaccatgcttgacagtggggatggtgtgttcagctgtgttgcttttacgccaaacataacgttttgcattgttgccaaaaagttacattttggtttcatctgaccagagcaccttcttccacatgtttggtgtgtctcccaggtggcttgtggcaaactttaaacaacacttttta

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU903875 True 224 lncRNA 0.46 1 31897388 31897611
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110531915 LOC106595846 coding upstream 139886 31753182 ~ 31757502 (+)
LOC110531892 LOC106577482 coding upstream 1299041 30374371 ~ 30598347 (+)
LOC110531891 NA coding upstream 1611149 30282637 ~ 30288163 (+)
stim2b LOC106577483 coding upstream 2423599 29383092 ~ 29473789 (+)
tbc1d19 tbc1d19 coding upstream 2515719 29354116 ~ 29381669 (+)
LOC110531917 LOC106608522 coding downstream 2449 31900060 ~ 31992396 (+)
LOC110531918 LOC106577443 coding downstream 105255 32002866 ~ 32027214 (+)
LOC118965935 NA coding downstream 180007 32077618 ~ 32078723 (+)
LOC110531922 LOC106577451 coding downstream 214181 32111792 ~ 32114299 (+)
zgc:112271 bola2 coding downstream 225148 32122682 ~ 32124851 (+)
G794130 NA non-coding upstream 6194 31890994 ~ 31891194 (+)
G794098 NA non-coding upstream 29531 31867643 ~ 31867857 (+)
G794094 NA non-coding upstream 30641 31866516 ~ 31866747 (+)
G793996 NA non-coding upstream 52029 31845076 ~ 31845359 (+)
G793994 NA non-coding upstream 56302 31840875 ~ 31841086 (+)
G794142 NA non-coding downstream 233 31897844 ~ 31898059 (+)
G794157 NA non-coding downstream 14981 31912592 ~ 31912800 (+)
G794165 NA non-coding downstream 25123 31922734 ~ 31922960 (+)
G794318 NA non-coding downstream 142759 32040370 ~ 32040643 (+)
G794377 NA non-coding downstream 206917 32104528 ~ 32127935 (+)
G793757 LOC107579696 other upstream 300470 31595996 ~ 31596918 (+)
rbpjb LOC106577485 other upstream 2555185 29248127 ~ 29342203 (+)
taf6l taf6l other upstream 4409865 27480038 ~ 27487523 (+)
G794892 NA other downstream 604236 32501847 ~ 32502355 (+)
G794893 NA other downstream 604785 32502396 ~ 32502749 (+)
G794886 LOC106577459 other downstream 685995 32583606 ~ 32587388 (+)
G796495 LOC106613263 other downstream 2223811 34121422 ~ 34121740 (+)

Expression


G794141 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G794141 Expression in each Bioproject

Bar chart with 10 bars.
G794141 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 25.
End of interactive chart.

Co-expression Network