G794912



Basic Information


Item Value
gene id G794912
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048573.1
NCBI id CM023227.2
chromosome length 79455637
location 32541167 ~ 32542273 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU904720
actcacacattgtctgtactgttttagcagtgaaaaagaatacccataaaaggacaccacatcctgccaaattccagctgcgctaattgtattgtgttcacagagctcacaagctatcagaaagttgtatggcaaccacctccggtgccaaatagaactggcagacatagacattcagtacaagaagaaaaagatggaaaatcttgcactggagttcgaaataaaaaagaggacaattaggaaactggaccttgaaataaaaaaacttgagagggaggtgagatatgccttcaatgtacactgtatgctaactgtaacacaaatgtattaatcattatttttctttcctcccccagctccaagaagatgacacagctcaaaataaaaattaggtatattctcgtaaagtcaagtgagccatgacatatgagctcttattgtgagcacacaggacggtggcatctttctaaggttttttttattttccc

Function


NR:

description
uncharacterized protein LOC110534718 isoform X2

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU904720 True 488 lncRNA 0.39 2 32541167 32542273

Neighbor


gene id symbol gene type direction distance location
ostc ostc coding upstream 1516 32520078 ~ 32539651 (+)
rpl34 rpl34 coding upstream 42565 32494490 ~ 32498602 (+)
zgc:112271 bola2 coding upstream 416414 32122682 ~ 32124851 (+)
LOC110531922 LOC106577451 coding upstream 426868 32111792 ~ 32114299 (+)
LOC118965935 NA coding upstream 462444 32077618 ~ 32078723 (+)
trnag-ucc-3 NA coding downstream 492672 33032239 ~ 33061120 (+)
trnag-ucc-4 NA coding downstream 493178 33035451 ~ 33035522 (+)
trnag-ucc-6 NA coding downstream 500319 33042592 ~ 33042663 (+)
trnag-ucc-7 NA coding downstream 501730 33044003 ~ 33044074 (+)
trnag-ucc-8 NA coding downstream 504538 33046811 ~ 33046882 (+)
G794894 NA non-coding upstream 37162 32503758 ~ 32504005 (+)
G794890 NA non-coding upstream 46921 32494034 ~ 32494246 (+)
G794871 NA non-coding upstream 60266 32480669 ~ 32480901 (+)
G794860 NA non-coding upstream 64844 32476120 ~ 32476323 (+)
G794853 NA non-coding upstream 72805 32467902 ~ 32468362 (+)
G794884 NA non-coding downstream 19244 32561517 ~ 32562743 (+)
G794932 NA non-coding downstream 85285 32627558 ~ 32651727 (+)
G794998 NA non-coding downstream 178347 32720620 ~ 32720875 (+)
G794999 NA non-coding downstream 180226 32722499 ~ 32722823 (+)
G795000 NA non-coding downstream 181142 32723415 ~ 32723665 (+)
G794893 NA other upstream 38418 32502396 ~ 32502749 (+)
G794892 NA other upstream 38812 32501847 ~ 32502355 (+)
LOC110531915 LOC106595846 other upstream 784722 31753182 ~ 31757502 (+)
G793757 LOC107579696 other upstream 944249 31595996 ~ 31596918 (+)
G794886 LOC106577459 other downstream 41333 32583606 ~ 32587388 (+)
G796495 LOC106613263 other downstream 1579149 34121422 ~ 34121740 (+)
G797056 NA other downstream 2013658 34555931 ~ 34556622 (+)
G797932 pphln other downstream 2822715 35364988 ~ 35372148 (+)
G799053 NA other downstream 3770856 36313129 ~ 36316805 (+)

Expression


G794912 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 60.
End of interactive chart.

G794912 Expression in each Bioproject

Bar chart with 19 bars.
G794912 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1000.
End of interactive chart.

Co-expression Network