G797107



Basic Information


Item Value
gene id G797107
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048573.1
NCBI id CM023227.2
chromosome length 79455637
location 34593643 ~ 34593845 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU907218
ccacatgacaacatggtagcaacacaacatggtagcagcacagcatggtagcagcacaaaacatggtacaaacattattgggcacagacaacagcacaaatgcaagaaggtagagacaatacatcatgcgaagcagccacaactgtcagtaagactgtccatgattgagtttttgaatgaagagatggagtgtaagactgtat

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU907218 True 203 lncRNA 0.43 1 34593643 34593845
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110531958 LOC106571859 coding downstream 62215 34429068 ~ 34531428 (-)
LOC110531957 LOC106571860 coding downstream 207770 34362170 ~ 34385873 (-)
LOC110531153 LOC106571861 coding downstream 231880 34359904 ~ 34361763 (-)
LOC110531953 LOC106571856 coding downstream 430467 34133570 ~ 34163176 (-)
LOC110531949 LOC106571850 coding downstream 559153 34006952 ~ 34034490 (-)
LOC118966030 NA coding upstream 2695 34596540 ~ 34607133 (-)
eif2d eif2d coding upstream 23655 34617500 ~ 34636294 (-)
LOC110533011 LOC106571887 coding upstream 121895 34715740 ~ 34721316 (-)
LOC110531962 LOC106571888 coding upstream 135489 34729334 ~ 34802834 (-)
LOC110531965 pphln coding upstream 770207 35364052 ~ 35372459 (-)
G797102 NA non-coding downstream 2511 34590744 ~ 34591132 (-)
G797096 NA non-coding downstream 5747 34587621 ~ 34587896 (-)
G797081 NA non-coding downstream 16380 34576589 ~ 34577263 (-)
G797075 NA non-coding downstream 20794 34572513 ~ 34572849 (-)
G797071 NA non-coding downstream 22832 34570155 ~ 34570811 (-)
G797122 NA non-coding upstream 5286 34599131 ~ 34604458 (-)
G797439 NA non-coding upstream 15516 34609361 ~ 34609566 (-)
G797443 NA non-coding upstream 18329 34612174 ~ 34612514 (-)
G797444 NA non-coding upstream 30800 34624645 ~ 34625099 (-)
G797480 LOC106571864 non-coding upstream 72663 34666508 ~ 34676144 (-)
G796733 rl32 other downstream 536094 34051059 ~ 34057549 (-)
G794311 LOC106577443 other downstream 2565375 32026071 ~ 32028445 (-)
G793842 NA other downstream 2931445 31661239 ~ 31662198 (-)
G793489 NA other downstream 3174670 31418455 ~ 31418973 (-)
G793472 NA other downstream 3189774 31403482 ~ 31403869 (-)
G797605 NA other upstream 276110 34869955 ~ 34875879 (-)
G798195 NA other upstream 760374 35354219 ~ 35354675 (-)
LOC110531966 LOC106571884 other upstream 792008 35381661 ~ 35400349 (-)
LOC118966032 LOC106571870 other upstream 898181 35492026 ~ 35521884 (-)
LOC110531979 brpf1 other upstream 1383577 35948544 ~ 35979307 (-)

Expression


G797107 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G797107 Expression in each Bioproject

Bar chart with 13 bars.
G797107 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Co-expression Network