G797804



Basic Information


Item Value
gene id G797804
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048573.1
NCBI id CM023227.2
chromosome length 79455637
location 35181177 ~ 35181441 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU907986
ttaacctctagcacttagccatcccggatccgggatcgtgaatacagcctcaagctcattaccataacgcaacgttaactattcatgaaaatcgcaaatgaaatgaaataaatatgctagctctcaagcttagccttttgttaacaacactgtcatctcagattttcaaaatatgcttctcaaccataggaaaacaataatttgtgtaacagtagctagctagcgtagcatttagcgttagcgttagcgttagcattcagcaggc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU907986 True 265 lncRNA 0.40 1 35181177 35181441
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110531155 LOC106571865 coding upstream 76795 34946140 ~ 35104382 (+)
LOC110531961 LOC106571864 coding upstream 498393 34642919 ~ 34682784 (+)
LOC110531960 NA coding upstream 568686 34610290 ~ 34612491 (+)
LOC118966029 NA coding upstream 788215 34385884 ~ 34392962 (+)
LOC110531955 143b2 coding upstream 831880 34344355 ~ 34349297 (+)
LOC110531964 LOC106571867 coding downstream 34430 35215871 ~ 35360678 (+)
LOC110531967 NA coding downstream 218238 35399679 ~ 35403549 (+)
LOC110531968 LOC106571869 coding downstream 240124 35421565 ~ 35469496 (+)
LOC110531969 LOC106571870 coding downstream 305927 35487368 ~ 35496138 (+)
LOC110531971 LOC106571873 coding downstream 363336 35544777 ~ 35551977 (+)
G797795 NA non-coding upstream 8638 35172320 ~ 35172539 (+)
G797789 NA non-coding upstream 12106 35168864 ~ 35169071 (+)
G797785 NA non-coding upstream 12978 35167909 ~ 35168199 (+)
G797775 NA non-coding upstream 19346 35161593 ~ 35161831 (+)
G797739 NA non-coding upstream 47927 35132962 ~ 35133250 (+)
G797808 NA non-coding downstream 3418 35184859 ~ 35185305 (+)
G797842 NA non-coding downstream 25445 35206886 ~ 35207193 (+)
G797844 NA non-coding downstream 26675 35208116 ~ 35208403 (+)
G798000 NA non-coding downstream 261151 35442592 ~ 35449033 (+)
G797056 NA other upstream 624555 34555931 ~ 34556622 (+)
G796495 LOC106613263 other upstream 1059437 34121422 ~ 34121740 (+)
G794886 LOC106577459 other upstream 2593789 32583606 ~ 32587388 (+)
G794893 NA other upstream 2678428 32502396 ~ 32502749 (+)
G794892 NA other upstream 2678822 32501847 ~ 32502355 (+)
G797932 pphln other downstream 183547 35364988 ~ 35372148 (+)
G799053 NA other downstream 1131688 36313129 ~ 36316805 (+)
G799578 LOC106571900 other downstream 1852977 37034418 ~ 37035918 (+)
G799858 LOC106571908 other downstream 2385804 37567245 ~ 37570411 (+)
G800834 NA other downstream 2888775 38070216 ~ 38071433 (+)

Expression


G797804 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

G797804 Expression in each Bioproject

Bar chart with 19 bars.
G797804 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network