G798195



Basic Information


Item Value
gene id G798195
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048573.1
NCBI id CM023227.2
chromosome length 79455637
location 35354219 ~ 35354675 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU908405
tcagaggtccgttaaaagcgcagagagcatcatgaagaacaaggaacacaccaggcaggtccgagatactgttgtgaagaagtttaaagccggatttggatacaaaaatatttcccaagctttaaacatcccaaggagcactgtgcaagcgataatattgaattggaaggagtatcagaccactgcaaatctaccaagacctggccgtccctctaaactttcagctcatacaaggaggagactgatcagagatgcagccaagaggcccatgatcactctggatgaactgcagagatctacagctgaggtgggagactctgtccataggacaacaacaatctggcctttatggaagagtggcaagaagaaag

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU908405 True 371 TUCP 0.46 2 35354219 35354675
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110531962 LOC106571888 coding downstream 551385 34729334 ~ 34802834 (-)
LOC110533011 LOC106571887 coding downstream 632903 34715740 ~ 34721316 (-)
eif2d eif2d coding downstream 717925 34617500 ~ 34636294 (-)
LOC118966030 NA coding downstream 747086 34596540 ~ 34607133 (-)
LOC110531958 LOC106571859 coding downstream 822791 34429068 ~ 34531428 (-)
LOC110531965 pphln coding upstream 9377 35364052 ~ 35372459 (-)
LOC110531966 LOC106571884 coding upstream 26986 35381661 ~ 35400349 (-)
LOC118966032 LOC106571870 coding upstream 140389 35492026 ~ 35521884 (-)
LOC110531156 wdr46 coding upstream 202192 35556867 ~ 35562538 (-)
LOC118936388 LOC106571889 coding upstream 209586 35564261 ~ 35566271 (-)
G797846 NA non-coding downstream 145323 35208631 ~ 35208896 (-)
G797809 NA non-coding downstream 168915 35184859 ~ 35185304 (-)
G797792 NA non-coding downstream 182916 35171097 ~ 35171303 (-)
G797764 NA non-coding downstream 200476 35153526 ~ 35153743 (-)
G797755 NA non-coding downstream 206587 35147423 ~ 35147632 (-)
G798223 NA non-coding upstream 52170 35406845 ~ 35407564 (-)
G798248 NA non-coding upstream 85606 35440281 ~ 35446932 (-)
G798325 NA non-coding upstream 228884 35583559 ~ 35583881 (-)
G798340 NA non-coding upstream 246128 35600803 ~ 35601047 (-)
G797605 NA other downstream 478340 34869955 ~ 34875879 (-)
G796733 rl32 other downstream 1296670 34051059 ~ 34057549 (-)
G794311 LOC106577443 other downstream 3325951 32026071 ~ 32028445 (-)
G793842 NA other downstream 3692021 31661239 ~ 31662198 (-)
G793489 NA other downstream 3935246 31418455 ~ 31418973 (-)
LOC110531979 brpf1 other upstream 622747 35948544 ~ 35979307 (-)
G798993 NA other upstream 795663 36150338 ~ 36150637 (-)
LOC110531982 LOC106571893 other upstream 1473221 36827882 ~ 36907700 (-)

Expression


G798195 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G798195 Expression in each Bioproject

Bar chart with 20 bars.
G798195 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network