G798744



Basic Information


Item Value
gene id G798744
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048573.1
NCBI id CM023227.2
chromosome length 79455637
location 35669911 ~ 35712373 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU909061
atcaatactacaatcatacgaccggtgtggaggaagagaggtggccctggaccgactgaacaccgtgcgcagatcgtgatattcctccggcacccctgtcaaatcaccaggctcctcctgtgaagaagagacagaggaaacaggagggatagcagacattaaacatttcacatgacaagagacgttccaggagaggatagaattactagaccaattaatggaaggattatgacaaactagccagggatggcccaaaacaacaggtgcaaaaggtgaacgaaaaattaaaaaagaaatggtttcactatgattaccagaaacagtgagggttaaaggtagcgtctcacgctgaatcctggggagaggactaccatccagggcgaacaaggccgtgggctcccttaactgtctgagaggaatgtcatgttcccgagcccaggtctcgtccataaaacagccctccgccccagagtctattaaggcactgcaggaagctg

Function


NR:

description
PREDICTED: retrotransposon-like protein 1

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU909061 True 497 lncRNA 0.49 2 35669911 35712373
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118936388 LOC106571889 coding downstream 103640 35564261 ~ 35566271 (-)
LOC110531156 wdr46 coding downstream 107373 35556867 ~ 35562538 (-)
LOC118966032 LOC106571870 coding downstream 148027 35492026 ~ 35521884 (-)
LOC110531966 LOC106571884 coding downstream 270353 35381661 ~ 35400349 (-)
LOC110531965 pphln coding downstream 297452 35364052 ~ 35372459 (-)
LOC110531974 LOC100136369 coding upstream 143735 35856108 ~ 35859824 (-)
LOC118936413 NA coding upstream 148272 35860645 ~ 35869013 (-)
LOC118966034 NA coding upstream 161781 35874154 ~ 35879299 (-)
LOC110531976 NA coding upstream 166924 35879297 ~ 35886033 (-)
LOC110531977 LOC106571877 coding upstream 184056 35896429 ~ 35904384 (-)
G798344 NA non-coding downstream 66261 35603433 ~ 35603650 (-)
G798340 NA non-coding downstream 68864 35600803 ~ 35601047 (-)
G798325 NA non-coding downstream 86030 35583559 ~ 35583881 (-)
G798248 NA non-coding downstream 222979 35440281 ~ 35446932 (-)
G798223 NA non-coding downstream 262347 35406845 ~ 35407564 (-)
G798836 NA non-coding upstream 101019 35813392 ~ 35813652 (-)
G798844 LOC106571875 non-coding upstream 109146 35821519 ~ 35825732 (-)
G798883 NA non-coding upstream 201824 35914197 ~ 35914434 (-)
G798890 NA non-coding upstream 218891 35931264 ~ 35932005 (-)
G798901 NA non-coding upstream 246711 35959084 ~ 35961739 (-)
G798195 NA other downstream 315236 35354219 ~ 35354675 (-)
G797605 NA other downstream 794032 34869955 ~ 34875879 (-)
G796733 rl32 other downstream 1612362 34051059 ~ 34057549 (-)
LOC110531979 brpf1 other upstream 265049 35948544 ~ 35979307 (-)
G798993 NA other upstream 437965 36150338 ~ 36150637 (-)
LOC110531982 LOC106571893 other upstream 1115523 36827882 ~ 36907700 (-)
G800318 NA other upstream 1632022 37344395 ~ 37345147 (-)
LOC110532015 LOC106566767 other upstream 3128836 38839265 ~ 38841685 (-)

Expression


G798744 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G798744 Expression in each Bioproject

Bar chart with 18 bars.
G798744 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network