G804255


Basic Information

Item Value
gene id G804255
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048573.1
NCBI id CM023227.2
chromosome length 79455637
location 40984482 ~ 40985245 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU915182
gcaaaattattcagcccctttactttcagtgcagcaaactctctccagaagttcagtgaggatctctgaatgatccaatgttgacctaaatgactaatgatgataaatacaatccacctgtgtgtaatcaagtctccgtataaatggacctgcactgtgatagtctcagaggtccgttaaaagcgcagagagcatcatgaagaacaaggaacacaccaggcaggtccgagatactgttgtgaagaagtttaaagccggatttggatacaaaaatatttcccaagctttaaacatcccaaggagcactgtgcaagcgtggtggtggcagcatcatggtttgggcctgcttttcttcagcagggacagggaagatggttaaaattgatgggaagatggatggagccaaatacaggaccattctggaagaaaacctgatggagtctgcaaaagacctgagactgggacggagatttgtcttccaacaagacaatgatccaaaacataaagcaaaatctacaatggaatggttcaaaaataaacatatccaggtgttagaatggccaagtcaaagtccagacctgaatccaatcgagaatctgtggaaagaactgaaaactgctgttcacaaatgctctccatccaacctcactgtgctcgagctgttttgcaaggaggaatgggaaaaaaattcagtctctcgatgtgcaaaactgatagagacataccccaagcgacttacagctgtaatcgcagcaaaaggtggc

Function

NR:

description
Tc1-like transporase

GO: NA

KEGG:

id description

RNA

RNA id representative length rna type GC content exon number start site end site
TU915182 True 764 TUCP 0.43 1 40984482 40985245
Loading

Neighbor

gene id symbol gene type direction distance location
LOC110531177 celsr3 coding downstream 12331 40918726 ~ 40972151 (-)
wdr6 wdr6 coding downstream 68409 40904738 ~ 40916073 (-)
LOC118966048 LOC106572305 coding downstream 80302 40898024 ~ 40904180 (-)
LOC110532079 LOC106572269 coding downstream 86898 40886478 ~ 40897584 (-)
LOC110532083 NA coding downstream 105537 40877041 ~ 40878945 (-)
dalrd3 dalrd3 coding upstream 224 40985469 ~ 41000703 (-)
impdh2 LOC106566785 coding upstream 28134 41013379 ~ 41024793 (-)
arih2 arih2 coding upstream 41005 41026250 ~ 41034402 (-)
xpc xpc coding upstream 56054 41041299 ~ 41053107 (-)
borcs6 LOC106572262 coding upstream 103773 41089018 ~ 41095989 (-)
G804247 NA non-coding downstream 216 40983404 ~ 40984266 (-)
G804262 LOC106572270 non-coding downstream 66004 40917907 ~ 40918478 (-)
G804273 NA non-coding downstream 196584 40787523 ~ 40787898 (-)
G804206 NA non-coding downstream 215898 40767109 ~ 40768584 (-)
G804259 NA non-coding upstream 23644 41008889 ~ 41009137 (-)
G804269 NA non-coding upstream 24806 41010051 ~ 41010825 (-)
G804353 NA non-coding upstream 50327 41035572 ~ 41035777 (-)
G804354 NA non-coding upstream 50575 41035820 ~ 41036083 (-)
G804355 NA non-coding upstream 51819 41037064 ~ 41037539 (-)
G804307 NA other downstream 72124 40862589 ~ 40912358 (-)
G804137 LOC106572278 other downstream 410532 40571014 ~ 40573950 (-)
selenok selenok other downstream 534542 40395732 ~ 40450018 (-)
LOC110531168 LOC106571968 other downstream 1016508 39961467 ~ 39996984 (-)
G804543 LOC106572259 other upstream 451785 41437030 ~ 41437971 (-)
LOC110532119 LOC106572245 other upstream 1142607 42125255 ~ 42141613 (-)
G806724 LOC106572208 other upstream 2346685 43331930 ~ 43339589 (-)
prdm16 prdm16 other upstream 2955321 43781726 ~ 44015554 (-)
tafa5l LOC106572193 other upstream 3263553 44247091 ~ 44292397 (-)

Expression

G804255 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G804255 Expression in each Bioproject

Bar chart with 19 bars.
G804255 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network