G806334



Basic Information


Item Value
gene id G806334
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048573.1
NCBI id CM023227.2
chromosome length 79455637
location 43116242 ~ 43116456 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU917530
acatagtgggctccttcattcttaagtggaagaagtttggaaacaccaagactcttcctagagctggccgcccgaccaaactgagcaatcgggggagaagggtcttggtcagagaggtgaccaagaacctgattgtcactctgacagaactccagagttcctctgtggagatgggcaaaccttccagaaggacaaccatatctgcagcactccac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU917530 True 215 lncRNA 0.51 1 43116242 43116456
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110532149 LOC106572217 coding upstream 153214 42935264 ~ 42963028 (+)
LOC110532148 LOC106572218 coding upstream 185252 42912383 ~ 42930990 (+)
LOC110532147 LOC106572219 coding upstream 204555 42903096 ~ 42911687 (+)
LOC110532144 LOC106572221 coding upstream 248940 42753276 ~ 42867302 (+)
foxp3-1 foxp3-1 coding upstream 368489 42698951 ~ 42747753 (+)
LOC110531181 LOC106572211 coding downstream 149061 43265517 ~ 43275006 (+)
taf10 LOC106572212 coding downstream 169385 43285841 ~ 43287979 (+)
ppih ppih coding downstream 171693 43288149 ~ 43323809 (+)
ybx1 LOC106572208 coding downstream 212912 43329368 ~ 43335690 (+)
acot7 acot7 coding downstream 392522 43508978 ~ 43579823 (+)
G806322 NA non-coding upstream 26493 43089491 ~ 43089749 (+)
G806318 NA non-coding upstream 30617 43085334 ~ 43085625 (+)
G806246 NA non-coding upstream 143714 42972253 ~ 42972528 (+)
G806245 NA non-coding upstream 145153 42970823 ~ 42971089 (+)
G806244 NA non-coding upstream 145503 42970513 ~ 42970739 (+)
G806399 NA non-coding downstream 105628 43222084 ~ 43222295 (+)
G806400 NA non-coding downstream 112180 43228636 ~ 43228927 (+)
G806403 LOC106572213 non-coding downstream 116413 43232869 ~ 43236516 (+)
G806404 NA non-coding downstream 121397 43237853 ~ 43238686 (+)
G806405 NA non-coding downstream 122246 43238702 ~ 43238919 (+)
G805600 NA other upstream 767456 42346176 ~ 42348786 (+)
G805451 NA other upstream 783804 42332093 ~ 42332438 (+)
LOC110532114 LOC106572334 other upstream 1091839 42021496 ~ 42027071 (+)
LOC110532096 LOC106572259 other upstream 1680819 41423598 ~ 41452922 (+)
G803728 NA other upstream 2094740 41020936 ~ 41021502 (+)
G807677 NA other downstream 1079259 44195715 ~ 44196041 (+)
G807841 NA other downstream 1326206 44442662 ~ 44453077 (+)
G809685 NA other downstream 3018275 46134731 ~ 46135732 (+)
G812143 NA other downstream 4865545 47982001 ~ 47982301 (+)
G812688 LOC106572106 other downstream 5428998 48545454 ~ 48570593 (+)

Expression


G806334 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

G806334 Expression in each Bioproject

Bar chart with 18 bars.
G806334 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network