G813099



Basic Information


Item Value
gene id G813099
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048573.1
NCBI id CM023227.2
chromosome length 79455637
location 49011334 ~ 49011612 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU925022
ggtcacactggtgggtggtataaggtgctttagtaacaaaacggatggcactgtgataaacagcatccagtttgctgagtagagtattggaagctattttgtagatgacatcgccgaagtcgaggatcggtaggatagtcagttttactagggtaagtttggtggcgtgagtgaaggaggctttgttgcggaatagaaagccgactctagatttgattttagattggagatgtttgatatgagtctggaaggagagtttacagtctaaccagacaccta

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU925022 True 279 lncRNA 0.44 1 49011334 49011612
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110532278 LOC105027762 coding upstream 13049 48994635 ~ 48998285 (+)
LOC110532277 LOC106572094 coding upstream 16799 48988442 ~ 48994535 (+)
klhdc8b LOC106572099 coding upstream 76002 48831069 ~ 48935332 (+)
si:dkey-32e6.3 LOC106572098 coding upstream 221589 48782956 ~ 48789745 (+)
usp19 NA coding upstream 228595 48747659 ~ 48782739 (+)
LOC110532282 LOC106572092 coding downstream 1551 49013163 ~ 49060073 (+)
LOC110532283 LOC106572090 coding downstream 52076 49063688 ~ 49081175 (+)
LOC110532284 LOC106572089 coding downstream 74212 49085824 ~ 49097702 (+)
LOC110532286 LOC106572086 coding downstream 148835 49160447 ~ 49161689 (+)
mrgbp mrgbp coding downstream 151937 49163549 ~ 49167417 (+)
G813074 etbr2 non-coding upstream 4624 48962187 ~ 49006710 (+)
G813076 NA non-coding upstream 35949 48967764 ~ 48975385 (+)
G812969 NA non-coding upstream 67905 48942199 ~ 48943429 (+)
G812968 NA non-coding upstream 71747 48939159 ~ 48939587 (+)
G813060 NA non-coding upstream 80907 48930216 ~ 48930427 (+)
G813100 NA non-coding downstream 34 49011646 ~ 49011948 (+)
G813125 NA non-coding downstream 70712 49082324 ~ 49082584 (+)
G813128 NA non-coding downstream 73305 49084917 ~ 49085116 (+)
G813135 NA non-coding downstream 91971 49103583 ~ 49103820 (+)
G813137 NA non-coding downstream 94366 49105978 ~ 49106213 (+)
G813071 NA other upstream 51343 48959749 ~ 48959991 (+)
G812688 LOC106572106 other upstream 440741 48545454 ~ 48570593 (+)
G812143 NA other upstream 1029033 47982001 ~ 47982301 (+)
G809685 NA other upstream 2875602 46134731 ~ 46135732 (+)
G813139 NA other downstream 103525 49115137 ~ 49115618 (+)
G815428 NA other downstream 1784602 50796214 ~ 50800381 (+)
G815610 NA other downstream 2066835 51078447 ~ 51078942 (+)
G815767 casz1 other downstream 2333760 51345372 ~ 51346494 (+)
LOC110532349 LOC106591969 other downstream 3311659 52323001 ~ 52325924 (+)

Expression


G813099 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 12.
End of interactive chart.

G813099 Expression in each Bioproject

Bar chart with 19 bars.
G813099 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network