G813128



Basic Information


Item Value
gene id G813128
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048573.1
NCBI id CM023227.2
chromosome length 79455637
location 49084917 ~ 49085116 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU925056
GGACAGAACACATTGAGAGAGTGGTGGGAAAGTGTAAGAAGGTGCAAAATGTGATGCGCTGTCTTATGGGGCAGGAGTAGACTATGGCAGTATAGCTTATGGTTCAGCAACCCGGACATCATTGGAAAGGCTAGGTGTCATACAGGGGCAAGGACTCAGAATATGTAGTGGGGCATTTCGGACGTCCCCAGTCTCTGCAC

Function


NR:

description
PREDICTED: uncharacterized protein LOC106532689

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU925056 True 200 lncRNA 0.50 1 49084917 49085116

Neighbor


gene id symbol gene type direction distance location
LOC110532283 LOC106572090 coding upstream 3742 49063688 ~ 49081175 (+)
LOC110532282 LOC106572092 coding upstream 24844 49013163 ~ 49060073 (+)
LOC110532278 LOC105027762 coding upstream 86632 48994635 ~ 48998285 (+)
LOC110532277 LOC106572094 coding upstream 90382 48988442 ~ 48994535 (+)
klhdc8b LOC106572099 coding upstream 149585 48831069 ~ 48935332 (+)
LOC110532284 LOC106572089 coding downstream 708 49085824 ~ 49097702 (+)
LOC110532286 LOC106572086 coding downstream 75331 49160447 ~ 49161689 (+)
mrgbp mrgbp coding downstream 78433 49163549 ~ 49167417 (+)
LOC118966186 NA coding downstream 99265 49184381 ~ 49186162 (+)
sulf2b LOC106572085 coding downstream 228070 49313186 ~ 49493787 (+)
G813125 NA non-coding upstream 2333 49082324 ~ 49082584 (+)
G813100 NA non-coding upstream 72969 49011646 ~ 49011948 (+)
G813099 NA non-coding upstream 73305 49011334 ~ 49011612 (+)
G813074 etbr2 non-coding upstream 78207 48962187 ~ 49006710 (+)
G813076 NA non-coding upstream 109532 48967764 ~ 48975385 (+)
G813135 NA non-coding downstream 18467 49103583 ~ 49103820 (+)
G813137 NA non-coding downstream 20862 49105978 ~ 49106213 (+)
G813140 NA non-coding downstream 30567 49115683 ~ 49116087 (+)
G813160 NA non-coding downstream 65347 49150463 ~ 49150752 (+)
G813487 NA non-coding downstream 73050 49158166 ~ 49158461 (+)
G813071 NA other upstream 124926 48959749 ~ 48959991 (+)
G812688 LOC106572106 other upstream 514324 48545454 ~ 48570593 (+)
G812143 NA other upstream 1102616 47982001 ~ 47982301 (+)
G809685 NA other upstream 2949185 46134731 ~ 46135732 (+)
G813139 NA other downstream 30021 49115137 ~ 49115618 (+)
G815428 NA other downstream 1711098 50796214 ~ 50800381 (+)
G815610 NA other downstream 1993331 51078447 ~ 51078942 (+)
G815767 casz1 other downstream 2260256 51345372 ~ 51346494 (+)
LOC110532349 LOC106591969 other downstream 3238155 52323001 ~ 52325924 (+)

Expression


G813128 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G813128 Expression in each Bioproject

Bar chart with 9 bars.
G813128 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 25.
End of interactive chart.

Co-expression Network