G814225



Basic Information


Item Value
gene id G814225
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048573.1
NCBI id CM023227.2
chromosome length 79455637
location 49839038 ~ 49839290 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU926240
tgtatgtcttccatttcctaataattgctcccacagttgatttcttcaaaccaagctgcttacctattgcagattcagtcttcccagcctggtgcatgtctacaattttgtttctggtgtcctttgacagctctttggtcttggccatagtggagtttggagtgtgactgtttgaggttgtggacaggtgtcttttatactgataacaagttcaaacaggtgccattaatacaggtaatgagtggaggacaga

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU926240 True 253 lncRNA 0.42 1 49839038 49839290
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110533019 gss coding upstream 35576 49800763 ~ 49803462 (+)
gss gss coding upstream 42007 49788722 ~ 49797031 (+)
LOC110531195 trpc4ap coding upstream 88872 49745378 ~ 49785055 (+)
LOC118966066 trpc4ap coding upstream 95712 49741863 ~ 49743326 (+)
edem2 edem2 coding upstream 101582 49725707 ~ 49737456 (+)
LOC118966067 NA coding downstream 42866 49882156 ~ 49917857 (+)
si:dkey-8e10.3 LOC106572072 coding downstream 117551 49956841 ~ 49968731 (+)
LOC110532304 LOC106566492 coding downstream 346175 50138196 ~ 50205006 (+)
LOC110532305 LOC106572068 coding downstream 385554 50224844 ~ 50359369 (+)
fam217b LOC106572066 coding downstream 563274 50402564 ~ 50408370 (+)
G813870 NA non-coding upstream 26873 49811934 ~ 49812165 (+)
G813822 NA non-coding upstream 98438 49729408 ~ 49740600 (+)
G813798 LOC105030512 non-coding upstream 149034 49657658 ~ 49690004 (+)
G813789 NA non-coding upstream 180447 49640220 ~ 49658591 (+)
G814281 NA non-coding downstream 39790 49879080 ~ 49879349 (+)
G814313 LOC106610265 non-coding downstream 102179 49941469 ~ 49941746 (+)
G814336 NA non-coding downstream 145136 49984426 ~ 49984958 (+)
G814483 NA non-coding downstream 354525 50193815 ~ 50198790 (+)
G813139 NA other upstream 723420 49115137 ~ 49115618 (+)
G813074 etbr2 other upstream 832328 48962187 ~ 49006710 (+)
G813071 NA other upstream 879047 48959749 ~ 48959991 (+)
G812688 LOC106572106 other upstream 1268445 48545454 ~ 48570593 (+)
G812143 NA other upstream 1856737 47982001 ~ 47982301 (+)
G815428 NA other downstream 956924 50796214 ~ 50800381 (+)
G815610 NA other downstream 1239157 51078447 ~ 51078942 (+)
G815767 casz1 other downstream 1506082 51345372 ~ 51346494 (+)
LOC110532349 LOC106591969 other downstream 2483981 52323001 ~ 52325924 (+)
LOC110532368 LOC106572016 other downstream 2887131 52692676 ~ 52734929 (+)

Expression


G814225 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G814225 Expression in each Bioproject

Bar chart with 18 bars.
G814225 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network