G815526



Basic Information


Item Value
gene id G815526
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048573.1
NCBI id CM023227.2
chromosome length 79455637
location 50920866 ~ 50921079 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU927654
tttttggtacccttccccagatctgtgccatgacacaatccagtctcggagctttacggacaattccttcaacctcatggcttggcttttgctctgacatgcactgtcaactgtgggaccttacatagacagttgtgtgcctttccaaatcatgtccaatcaattggatttaccacaggtggaatccaatcaagttgtagaaacatctcaaaga

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU927654 True 214 lncRNA 0.44 1 50920866 50921079

Neighbor


gene id symbol gene type direction distance location
si:dkey-178k16.1 LOC106572064 coding upstream 363369 50445552 ~ 50557497 (+)
LOC118966068 NA coding upstream 492772 50423446 ~ 50428094 (+)
fam217b LOC106572066 coding upstream 512496 50402564 ~ 50408370 (+)
LOC110532305 LOC106572068 coding upstream 561503 50224844 ~ 50359369 (+)
LOC110532304 LOC106566492 coding upstream 715860 50138196 ~ 50205006 (+)
cntn3a.2 LOC106572060 coding downstream 44638 50965717 ~ 51041645 (+)
exosc10 exosc10 coding downstream 123336 51044415 ~ 51056932 (+)
srm srm coding downstream 139993 51061072 ~ 51067904 (+)
cort LOC106572313 coding downstream 185248 51106327 ~ 51107746 (+)
LOC110531197 NA coding downstream 204056 51125135 ~ 51127512 (+)
G815517 NA non-coding upstream 6712 50913924 ~ 50914154 (+)
G815516 NA non-coding upstream 8312 50912344 ~ 50912554 (+)
G815509 NA non-coding upstream 20219 50900177 ~ 50900647 (+)
G815427 NA non-coding upstream 124702 50795675 ~ 50796164 (+)
G815426 NA non-coding upstream 125433 50795214 ~ 50795433 (+)
G815528 NA non-coding downstream 1696 50922775 ~ 50923001 (+)
G815536 NA non-coding downstream 16929 50938008 ~ 50938217 (+)
G815543 NA non-coding downstream 24333 50945412 ~ 50945755 (+)
G815552 NA non-coding downstream 32674 50953753 ~ 50954424 (+)
G815561 NA non-coding downstream 86279 51007358 ~ 51069498 (+)
G815428 NA other upstream 120485 50796214 ~ 50800381 (+)
G813139 NA other upstream 1805248 49115137 ~ 49115618 (+)
G813074 etbr2 other upstream 1914156 48962187 ~ 49006710 (+)
G813071 NA other upstream 1960875 48959749 ~ 48959991 (+)
G812688 LOC106572106 other upstream 2350273 48545454 ~ 48570593 (+)
G815610 NA other downstream 157368 51078447 ~ 51078942 (+)
G815767 casz1 other downstream 424293 51345372 ~ 51346494 (+)
LOC110532349 LOC106591969 other downstream 1402192 52323001 ~ 52325924 (+)
LOC110532368 LOC106572016 other downstream 1805342 52692676 ~ 52734929 (+)
G819897 NA other downstream 3805792 54726871 ~ 54727376 (+)

Expression


G815526 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G815526 Expression in each Bioproject

Bar chart with 16 bars.
G815526 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Co-expression Network