G815610



Basic Information


Item Value
gene id G815610
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048573.1
NCBI id CM023227.2
chromosome length 79455637
location 51078447 ~ 51078942 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU927741
cctttactttcagtgcagcaaactctctccagaagttcagtgaggatctctgaatgatccaatgttgacctaaatgactaatgatgataaatacaatccacctgtgtgtaatcaagtctccgtataaatgcacctgcactctgatagtctcagaggtccgttaaaagcgcagagagcatcatgaagaacaaggaacacaccaggcaggtccgagatactgttgtgaagaagtttaaagccggatttggatacaacaagatttcccaagctttaaacatcccaaggagcacggtgcaagcgataatattgaaatggaaggagtatcagaccactgcaaatctaccaagacctggccgtccctctaaactttcagctcatacaaggagaagactgatcagagatgcagccaagaggcccatgatcactctggatgaactgcagagatctacagctgaggtgggagactctgtccataggacaacaatcagtcgtatat

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU927741 True 496 TUCP 0.45 1 51078447 51078942
Loading

Neighbor


gene id symbol gene type direction distance location
srm srm coding upstream 10543 51061072 ~ 51067904 (+)
exosc10 exosc10 coding upstream 21515 51044415 ~ 51056932 (+)
cntn3a.2 LOC106572060 coding upstream 36802 50965717 ~ 51041645 (+)
si:dkey-178k16.1 LOC106572064 coding upstream 520950 50445552 ~ 50557497 (+)
LOC118966068 NA coding upstream 650353 50423446 ~ 50428094 (+)
cort LOC106572313 coding downstream 27385 51106327 ~ 51107746 (+)
LOC110531197 NA coding downstream 46193 51125135 ~ 51127512 (+)
masp2 masp2 coding downstream 94820 51173762 ~ 51181734 (+)
pex14 pex14 coding downstream 123791 51202733 ~ 51319382 (+)
tardbpl tardbp coding downstream 626924 51705866 ~ 51710352 (+)
G815561 NA non-coding upstream 8949 51007358 ~ 51069498 (+)
G815580 NA non-coding upstream 61666 51015307 ~ 51016781 (+)
G815552 NA non-coding upstream 124023 50953753 ~ 50954424 (+)
G815543 NA non-coding upstream 132692 50945412 ~ 50945755 (+)
G815536 NA non-coding upstream 140230 50938008 ~ 50938217 (+)
G815611 NA non-coding downstream 614 51079556 ~ 51088643 (+)
G815629 NA non-coding downstream 18420 51097362 ~ 51097596 (+)
G815630 NA non-coding downstream 18837 51097779 ~ 51098009 (+)
G815643 NA non-coding downstream 39158 51118100 ~ 51118396 (+)
G815734 NA non-coding downstream 179967 51258909 ~ 51264781 (+)
G815428 NA other upstream 278066 50796214 ~ 50800381 (+)
G813139 NA other upstream 1962829 49115137 ~ 49115618 (+)
G813074 etbr2 other upstream 2071737 48962187 ~ 49006710 (+)
G813071 NA other upstream 2118456 48959749 ~ 48959991 (+)
G812688 LOC106572106 other upstream 2507854 48545454 ~ 48570593 (+)
G815767 casz1 other downstream 266430 51345372 ~ 51346494 (+)
LOC110532349 LOC106591969 other downstream 1244329 52323001 ~ 52325924 (+)
LOC110532368 LOC106572016 other downstream 1647479 52692676 ~ 52734929 (+)
G819897 NA other downstream 3647929 54726871 ~ 54727376 (+)
G820665 NA other downstream 4154316 55233258 ~ 55233798 (+)

Expression


G815610 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G815610 Expression in each Bioproject

Bar chart with 18 bars.
G815610 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network