G815767 (casz1)



Basic Information


Item Value
gene id G815767
gene name casz1
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048573.1
NCBI id CM023227.2
chromosome length 79455637
location 51345372 ~ 51346494 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU927907
CTGGTTGGGACATAGACACTGGAGGGAGAAGTAGGAGAACTGGTCTCGAACGTTGACCAGGTGGTTGTTAGGATTGATGTGGTCCAAGCAGTGGGATTCGGCCTTCCCCGAGGTCTTGCAGACGTACTTGCAGTTCCCGAAGAGACAGTGGAAGTGGACCTTGTTGGAGTACTTACAGTCAGTGGCCAGGCAAGGGTCACTGTATGAATTGTCCTGGAACTGCAGGAAGCCCGGTTTGACCTGTGGCTTGGCGTTCTCCAGAGAGGTGGTGGCCAGCGGCGAATTGGCAGGCAGGTTAGGCATGGAGGCATTGAGCTGTGGGATGCTGCCCGTCAGCTGCTTCCATGCCAGCAGTGAGGGGGAGGAGCCATAGCCGCCGCCTGACGAGGATGACATGTTGGCCACGTCCATGGCGGGGTTGTTAGCCATGGAGACAGGGGCGGTGGACTGGTGGGATGCTCCGTCGCCGCAGTCCTTGACTTTGTTGAAGTGAGGCTCTGATTTCACCTTCAGCGTGGCTCGTAGGTGGAAGCTGAACAGATGGACATGGTGGGGACACACTAAGTCAGATCTTTCATTCAGT

Function


symbol description
casz1 Predicted to enable metal ion binding activity. Predicted to be involved in regulation of neuron differentiation and regulation of transcription, DNA-templated. Predicted to be active in nucleus. Is expressed in several structures, including adaxial cell; cardiovascular system; hindbrain neural plate; musculature system; and nervous system. Orthologous to human CASZ1 (castor zinc finger 1).

NR:

description
PREDICTED: zinc finger protein castor homolog 1 isoform X6

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU927907 True 583 TUCP 0.57 2 51345372 51346494

Neighbor


gene id symbol gene type direction distance location
pex14 pex14 coding upstream 25990 51202733 ~ 51319382 (+)
masp2 masp2 coding upstream 163638 51173762 ~ 51181734 (+)
LOC110531197 NA coding upstream 217860 51125135 ~ 51127512 (+)
cort LOC106572313 coding upstream 237626 51106327 ~ 51107746 (+)
srm srm coding upstream 277468 51061072 ~ 51067904 (+)
tardbpl tardbp coding downstream 359372 51705866 ~ 51710352 (+)
lzic lzic coding downstream 574652 51921146 ~ 51924442 (+)
LOC110532337 LOC106572044 coding downstream 827516 52174010 ~ 52176441 (+)
LOC110532339 LOC107599000 coding downstream 835734 52182228 ~ 52189437 (+)
si:dkey-6n6.1 LOC106572038 coding downstream 860732 52207226 ~ 52216054 (+)
G815696 NA non-coding upstream 12278 51331995 ~ 51333094 (+)
G815697 NA non-coding upstream 13944 51330847 ~ 51331428 (+)
G815695 NA non-coding upstream 19120 51325904 ~ 51326252 (+)
G815735 NA non-coding upstream 78294 51261373 ~ 51267078 (+)
G815734 NA non-coding upstream 80591 51258909 ~ 51264781 (+)
G815768 casz1 non-coding downstream 1737 51348231 ~ 51350203 (+)
G816426 NA non-coding downstream 252965 51599459 ~ 51599793 (+)
G816427 NA non-coding downstream 253482 51599976 ~ 51600326 (+)
G816504 NA non-coding downstream 351669 51698163 ~ 51698389 (+)
G816505 NA non-coding downstream 354205 51700699 ~ 51700970 (+)
G815610 NA other upstream 266430 51078447 ~ 51078942 (+)
G815428 NA other upstream 544991 50796214 ~ 50800381 (+)
G813139 NA other upstream 2229754 49115137 ~ 49115618 (+)
G813074 etbr2 other upstream 2338662 48962187 ~ 49006710 (+)
G813071 NA other upstream 2385381 48959749 ~ 48959991 (+)
LOC110532349 LOC106591969 other downstream 976777 52323001 ~ 52325924 (+)
LOC110532368 LOC106572016 other downstream 1379927 52692676 ~ 52734929 (+)
G819897 NA other downstream 3380377 54726871 ~ 54727376 (+)
G820665 NA other downstream 3886764 55233258 ~ 55233798 (+)
dlgap4a dlgap4 other downstream 4184543 55531033 ~ 55647541 (+)

Expression


G815767(casz1) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 0.3.
End of interactive chart.

G815767(casz1) Expression in each Bioproject

Bar chart with 6 bars.
G815767(casz1) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1.25.
End of interactive chart.

Co-expression Network