G816745 (tmem201)


Basic Information

Item Value
gene id G816745
gene name tmem201
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048573.1
NCBI id CM023227.2
chromosome length 79455637
location 52132671 ~ 52133015 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU928921
CCTAGACAGACACCAGTGATACAGGTCAGCAGGCCAATGGAGACCACAGCCATCTGATGGTTCCTTCCATACTGCCAGACAAGCTTTGCATTCTCTACGGCCTCCTCTGGAAGCAGCTCTAGCAGGTCTTGCAACACCTGTCCAGCCTCGCTGCTACCGTTTTTGGGAGTGGATTTGTTGGAGGGAGCAGGCTTTGGAGGGATGATCCCCCCGCTTAGTGTTTGGGGTGCCCCTGCGGATGCAGTTTGGTCCCCAGAGCCATACAATGCTGTTGCAACTAGGAAGGCACAGGTGAAGAACGCCATGACACGAAGCAATATCACTCCAACTGGTGTGCTGAAGGAG

Function

symbol description
tmem201 Predicted to enable actin filament binding activity and lamin binding activity. Predicted to be involved in nuclear migration along microtubule. Predicted to be located in membrane and nucleus. Predicted to be integral component of nuclear inner membrane. Predicted to be active in nuclear membrane. Orthologous to human TMEM201 (transmembrane protein 201).

NR:

description
transmembrane protein 201 isoform X2

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU928921 True 345 lncRNA 0.54 1 52132671 52133015

Neighbor

gene id symbol gene type direction distance location
lzic lzic coding upstream 208229 51921146 ~ 51924442 (+)
tardbpl tardbp coding upstream 422319 51705866 ~ 51710352 (+)
pex14 pex14 coding upstream 813289 51202733 ~ 51319382 (+)
masp2 masp2 coding upstream 950937 51173762 ~ 51181734 (+)
LOC110531197 NA coding upstream 1005159 51125135 ~ 51127512 (+)
LOC110532337 LOC106572044 coding downstream 40995 52174010 ~ 52176441 (+)
LOC110532339 LOC107599000 coding downstream 49213 52182228 ~ 52189437 (+)
si:dkey-6n6.1 LOC106572038 coding downstream 74211 52207226 ~ 52216054 (+)
LOC110531199 LOC106572039 coding downstream 87822 52220837 ~ 52224935 (+)
dedd LOC106572035 coding downstream 96739 52229754 ~ 52234943 (+)
G816744 NA non-coding upstream 233 52128255 ~ 52132438 (+)
G816742 tmem201 non-coding upstream 6654 52125800 ~ 52126017 (+)
G816741 NA non-coding upstream 6952 52125378 ~ 52125719 (+)
G816740 NA non-coding upstream 7927 52124543 ~ 52124744 (+)
G816737 NA non-coding upstream 14231 52118236 ~ 52118440 (+)
G816749 NA non-coding downstream 5609 52138624 ~ 52138927 (+)
G816751 NA non-coding downstream 7245 52140260 ~ 52140497 (+)
G816752 NA non-coding downstream 8607 52141622 ~ 52141837 (+)
G816753 NA non-coding downstream 9542 52142557 ~ 52142845 (+)
G816716 NA non-coding downstream 15449 52148464 ~ 52148676 (+)
G815767 casz1 other upstream 786177 51345372 ~ 51346494 (+)
G815610 NA other upstream 1053729 51078447 ~ 51078942 (+)
G815428 NA other upstream 1332290 50796214 ~ 50800381 (+)
G813139 NA other upstream 3017053 49115137 ~ 49115618 (+)
G813074 etbr2 other upstream 3125961 48962187 ~ 49006710 (+)
LOC110532349 LOC106591969 other downstream 190256 52323001 ~ 52325924 (+)
LOC110532368 LOC106572016 other downstream 593406 52692676 ~ 52734929 (+)
G819897 NA other downstream 2593856 54726871 ~ 54727376 (+)
G820665 NA other downstream 3100243 55233258 ~ 55233798 (+)
dlgap4a dlgap4 other downstream 3398022 55531033 ~ 55647541 (+)

Expression


Co-expression Network