G816729



Basic Information


Item Value
gene id G816729
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048573.1
NCBI id CM023227.2
chromosome length 79455637
location 52158839 ~ 52159827 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU928904
TTTTGTTCTCTGGTCCTTTTGGCTCCTTCTCCACAGGGGGGATCACACTGACTCCACTCACTCCATTCACTCCACTTACCATCAAAGTGACATGAGTTAATGTCATAGCAGGCCCTGTAGTCTGTAATCTTTCCTTCACACGTCTTCCCATCAAAACCTGCGTGTTCACACCATCTTTGCCGTCTTTGCTGTCCACCAATTTTTCGACACCTAATTTTTCCTCTATTAGATTTACATTCTTCCCATCTCCCCCAC

Function


NR:

description
unnamed protein product

GO: NA

KEGG:

id description

RNA


RNA id representative length rna type GC content exon number start site end site
TU928904 True 255 lncRNA 0.45 2 52158839 52159827
Loading

Neighbor


gene id symbol gene type direction distance location
lzic lzic coding upstream 234397 51921146 ~ 51924442 (+)
tardbpl tardbp coding upstream 448487 51705866 ~ 51710352 (+)
pex14 pex14 coding upstream 839457 51202733 ~ 51319382 (+)
masp2 masp2 coding upstream 977105 51173762 ~ 51181734 (+)
LOC110531197 NA coding upstream 1031327 51125135 ~ 51127512 (+)
LOC110532337 LOC106572044 coding downstream 14183 52174010 ~ 52176441 (+)
LOC110532339 LOC107599000 coding downstream 22401 52182228 ~ 52189437 (+)
si:dkey-6n6.1 LOC106572038 coding downstream 47399 52207226 ~ 52216054 (+)
LOC110531199 LOC106572039 coding downstream 61010 52220837 ~ 52224935 (+)
dedd LOC106572035 coding downstream 69927 52229754 ~ 52234943 (+)
G816765 NA non-coding upstream 1496 52157128 ~ 52157343 (+)
G816759 NA non-coding upstream 8910 52149729 ~ 52149929 (+)
G816758 NA non-coding upstream 9227 52149238 ~ 52149612 (+)
G816716 NA non-coding upstream 10163 52148464 ~ 52148676 (+)
G816753 NA non-coding upstream 15994 52142557 ~ 52142845 (+)
G816778 NA non-coding downstream 12652 52172479 ~ 52172720 (+)
G816781 NA non-coding downstream 16711 52176538 ~ 52176741 (+)
G816788 NA non-coding downstream 39136 52198963 ~ 52199354 (+)
LOC118966072 LOC106572034 non-coding downstream 45017 52204844 ~ 52253412 (+)
LOC110531200 LOC106572034 non-coding downstream 89718 52246372 ~ 52250891 (+)
G815767 casz1 other upstream 812345 51345372 ~ 51346494 (+)
G815610 NA other upstream 1079897 51078447 ~ 51078942 (+)
G815428 NA other upstream 1358458 50796214 ~ 50800381 (+)
G813139 NA other upstream 3043221 49115137 ~ 49115618 (+)
G813074 etbr2 other upstream 3152129 48962187 ~ 49006710 (+)
LOC110532349 LOC106591969 other downstream 163444 52323001 ~ 52325924 (+)
LOC110532368 LOC106572016 other downstream 566594 52692676 ~ 52734929 (+)
G819897 NA other downstream 2567044 54726871 ~ 54727376 (+)
G820665 NA other downstream 3073431 55233258 ~ 55233798 (+)
dlgap4a dlgap4 other downstream 3371210 55531033 ~ 55647541 (+)

Expression


G816729 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 400.
End of interactive chart.

G816729 Expression in each Bioproject

Bar chart with 13 bars.
G816729 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 6000.
End of interactive chart.

Co-expression Network