G816989



Basic Information


Item Value
gene id G816989
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048573.1
NCBI id CM023227.2
chromosome length 79455637
location 52596812 ~ 52597039 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU929195
cttcttcacaacagtatctcggacctgcctggtgtgttccttgttcttcatgatgctctctgcgcttttaacggacctctgagactattacagtgcaggtgcatttatacggagacttgattacacacaggtggattgtatttatcatcattagtcatttaggtcaacattggatcattcagagatcctcactgatcttctggagagagtttgctgcactgaaagtaa

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU929195 True 228 lncRNA 0.43 1 52596812 52597039
Loading

Neighbor


gene id symbol gene type direction distance location
vwa1 LOC106572023 coding upstream 29287 52550127 ~ 52567525 (+)
htr6 LOC106572282 coding upstream 82349 52513511 ~ 52514463 (+)
LOC118936401 LOC106566850 coding upstream 92218 52502997 ~ 52504594 (+)
sike1 sike1 coding upstream 108579 52485523 ~ 52488233 (+)
LOC110532349 LOC106591969 coding upstream 270888 52323001 ~ 52325924 (+)
LOC110532365 LOC106572021 coding downstream 9404 52606443 ~ 52621080 (+)
LOC110532366 NA coding downstream 62635 52659674 ~ 52663309 (+)
LOC110531201 NA coding downstream 84472 52681511 ~ 52684202 (+)
LOC110532368 LOC106572016 coding downstream 95637 52692676 ~ 52734929 (+)
LOC110532370 LOC106572015 coding downstream 153174 52750213 ~ 52787156 (+)
G816988 NA non-coding upstream 228 52595984 ~ 52596584 (+)
G816985 NA non-coding upstream 4449 52592050 ~ 52592363 (+)
G816981 NA non-coding upstream 8099 52588433 ~ 52588713 (+)
G816969 NA non-coding upstream 23988 52570934 ~ 52572824 (+)
G816972 NA non-coding upstream 26666 52569063 ~ 52570146 (+)
G817016 NA non-coding downstream 49895 52646934 ~ 52647156 (+)
G817021 NA non-coding downstream 57620 52654659 ~ 52654926 (+)
G817215 NA non-coding downstream 436100 53033139 ~ 53033358 (+)
G817221 NA non-coding downstream 441090 53038129 ~ 53038474 (+)
G815767 casz1 other upstream 1250318 51345372 ~ 51346494 (+)
G815610 NA other upstream 1517870 51078447 ~ 51078942 (+)
G815428 NA other upstream 1796431 50796214 ~ 50800381 (+)
G813139 NA other upstream 3481194 49115137 ~ 49115618 (+)
G819897 NA other downstream 2129832 54726871 ~ 54727376 (+)
G820665 NA other downstream 2636219 55233258 ~ 55233798 (+)
dlgap4a dlgap4 other downstream 2933998 55531033 ~ 55647541 (+)
G820944 NA other downstream 3100601 55697640 ~ 55697978 (+)

Expression


G816989 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G816989 Expression in each Bioproject

Bar chart with 19 bars.
G816989 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1500.
End of interactive chart.

Co-expression Network