G820398



Basic Information


Item Value
gene id G820398
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048573.1
NCBI id CM023227.2
chromosome length 79455637
location 54754248 ~ 54754641 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU932916
ataagattctggcctgaatgccaaacatcacgtctggaggaaacctgccaccatccctacagtgaagcatggtggtagcagcatcatgctgtggggatgtttttcagcggcagggactgggagactagtcaggatcgaggcaaagatgaacggagcaaagtacagagagatttttgatgaaaacctgctccagagcgctcaggacctcagactggggcgaaggttcaccttccaacagggcaacgaccctaagcacacagccaagacaacgcaggagtggcttcgtgacaagtctctgaatgtccttgagtggcccagccagagcccagacttgaacccggtcgaacatctctggagagaactgaaaatagctgtgcagcgacgctccccatcc

Function


NR:

description
TC1-like transposase

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU932916 True 394 TUCP 0.54 1 54754248 54754641
Loading

Neighbor


gene id symbol gene type direction distance location
smim1 NA coding downstream 444205 54308615 ~ 54310043 (-)
cep104 cep104 coding downstream 459328 54247726 ~ 54294920 (-)
LOC110532394 LOC106571994 coding downstream 509726 54242412 ~ 54244522 (-)
LOC110533021 NA coding downstream 646987 54103925 ~ 54107261 (-)
LOC110531203 NA coding downstream 740704 54005547 ~ 54065096 (-)
chchd6a chch6 coding upstream 96221 54850862 ~ 54915395 (-)
LOC110532399 LOC106566893 coding upstream 163829 54918470 ~ 54921210 (-)
LOC110531207 LOC106572365 coding upstream 180819 54935460 ~ 55003862 (-)
LOC110532402 vdr0 coding upstream 280303 55024513 ~ 55114740 (-)
LOC110532403 LOC106572364 coding upstream 400736 55155377 ~ 55184333 (-)
G820397 NA non-coding downstream 441 54752948 ~ 54753807 (-)
G820396 NA non-coding downstream 1365 54752669 ~ 54752883 (-)
G820394 NA non-coding downstream 1991 54752042 ~ 54752257 (-)
G820386 NA non-coding downstream 15851 54738146 ~ 54738397 (-)
G820385 NA non-coding downstream 16191 54737772 ~ 54738057 (-)
G820399 NA non-coding upstream 776 54755417 ~ 54755664 (-)
G820400 NA non-coding upstream 1068 54755709 ~ 54755927 (-)
plxna1a LOC106572368 non-coding upstream 7168 54518209 ~ 54797805 (-)
G820484 NA non-coding upstream 119433 54874074 ~ 54876704 (-)
G820487 NA non-coding upstream 123553 54878194 ~ 54878690 (-)
G818117 NA other downstream 2022625 52727167 ~ 52731623 (-)
LOC110532367 LOC106572017 other downstream 2085528 52663417 ~ 52668762 (-)
G817848 NA other downstream 2600606 52153282 ~ 52153642 (-)
G820738 NA other upstream 554237 55308878 ~ 55309236 (-)
G820757 NA other upstream 564767 55319408 ~ 55320016 (-)
G821013 LOC106572358 other upstream 667902 55422543 ~ 55423559 (-)
G821851 LOC106584099 other upstream 1231319 55985960 ~ 55986517 (-)
LOC110532429 NA other upstream 1378363 56133004 ~ 56143428 (-)

Expression


G820398 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

G820398 Expression in each Bioproject

Bar chart with 21 bars.
G820398 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 750.
End of interactive chart.

Co-expression Network