G822434



Basic Information


Item Value
gene id G822434
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048573.1
NCBI id CM023227.2
chromosome length 79455637
location 56804054 ~ 56804267 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU935094
tctgtggatctgttggggcggtatgcaaattggagtgggtctagggtttctggaattatggtgttgatgtgagccatgaccagcctttcaaagcacttcatggctaccgacgtgagtgctaggggatggtagtcatttaggcaggttaccttggtgttcttggggacaaggactatggtggtctgcttgaaacatgtaggtattacagactcgg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU935094 True 214 lncRNA 0.49 1 56804054 56804267

Neighbor


gene id symbol gene type direction distance location
LOC110532437 LOC106572423 coding upstream 95727 56661757 ~ 56708327 (+)
LOC110532435 LOC106572422 coding upstream 151970 56645780 ~ 56652084 (+)
LOC110532433 LOC106572420 coding upstream 162071 56590691 ~ 56641983 (+)
LOC110531212 LOC106567287 coding upstream 340507 56246710 ~ 56463547 (+)
LOC110532427 LOC106572343 coding upstream 673641 56125754 ~ 56132936 (+)
LOC110532442 eif4e3 coding downstream 26477 56830744 ~ 56839626 (+)
LOC110532441 LOC106572418 coding downstream 35450 56839717 ~ 56863877 (+)
LOC110532445 LOC106572414 coding downstream 110315 56914582 ~ 56946999 (+)
LOC110532447 lmod3 coding downstream 143211 56947478 ~ 56948805 (+)
LOC110531214 lmod3 coding downstream 144537 56948804 ~ 56950054 (+)
G822423 NA non-coding upstream 14123 56789698 ~ 56789931 (+)
G822412 NA non-coding upstream 27942 56775842 ~ 56776112 (+)
G822403 NA non-coding upstream 42375 56761389 ~ 56761679 (+)
G822399 NA non-coding upstream 45062 56758588 ~ 56758992 (+)
G822390 NA non-coding upstream 57136 56746707 ~ 56746918 (+)
G822435 NA non-coding downstream 413 56804680 ~ 56804905 (+)
G822436 NA non-coding downstream 847 56805114 ~ 56805324 (+)
G822438 NA non-coding downstream 2121 56806388 ~ 56808544 (+)
G822470 NA non-coding downstream 65812 56870079 ~ 56871432 (+)
G822471 NA non-coding downstream 68118 56872385 ~ 56872717 (+)
G822404 NA other upstream 40514 56762625 ~ 56763540 (+)
G822283 NA other upstream 231097 56572607 ~ 56572957 (+)
LOC110532426 NA other upstream 679869 56119005 ~ 56124213 (+)
G821409 pacsin1 other upstream 740399 56061706 ~ 56063655 (+)
LOC110532462 LOC106572392 other downstream 538134 57342345 ~ 57958962 (+)
G823373 NA other downstream 1224352 58028619 ~ 58028857 (+)
G823467 NA other downstream 1400996 58205263 ~ 58244984 (+)
G823459 LOC106572386 other downstream 1442847 58216176 ~ 58250307 (+)
LOC110532478 LOC106572378 other downstream 1584404 58385510 ~ 58390570 (+)

Expression


G822434 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G822434 Expression in each Bioproject

Bar chart with 17 bars.
G822434 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network