G822435



Basic Information


Item Value
gene id G822435
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048573.1
NCBI id CM023227.2
chromosome length 79455637
location 56804680 ~ 56804905 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU935095
cacattcccagtgggtcagaagtttacatacactaaattagtatttggtagatttgcttttaaattgtttaacttgggtcaaacgtttcaggtagccttccacaagcttcccacaataagttgggagaattttggcccattcctcctgacagagctggtgaaactgagtcaggtttgtagtccttgctcgcacactctttttcagttctgcccacacattttctat

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU935095 True 226 lncRNA 0.42 1 56804680 56804905
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110532437 LOC106572423 coding upstream 96353 56661757 ~ 56708327 (+)
LOC110532435 LOC106572422 coding upstream 152596 56645780 ~ 56652084 (+)
LOC110532433 LOC106572420 coding upstream 162697 56590691 ~ 56641983 (+)
LOC110531212 LOC106567287 coding upstream 341133 56246710 ~ 56463547 (+)
LOC110532427 LOC106572343 coding upstream 674267 56125754 ~ 56132936 (+)
LOC110532442 eif4e3 coding downstream 25839 56830744 ~ 56839626 (+)
LOC110532441 LOC106572418 coding downstream 34812 56839717 ~ 56863877 (+)
LOC110532445 LOC106572414 coding downstream 109677 56914582 ~ 56946999 (+)
LOC110532447 lmod3 coding downstream 142573 56947478 ~ 56948805 (+)
LOC110531214 lmod3 coding downstream 143899 56948804 ~ 56950054 (+)
G822434 NA non-coding upstream 413 56804054 ~ 56804267 (+)
G822423 NA non-coding upstream 14749 56789698 ~ 56789931 (+)
G822412 NA non-coding upstream 28568 56775842 ~ 56776112 (+)
G822403 NA non-coding upstream 43001 56761389 ~ 56761679 (+)
G822399 NA non-coding upstream 45688 56758588 ~ 56758992 (+)
G822436 NA non-coding downstream 209 56805114 ~ 56805324 (+)
G822438 NA non-coding downstream 1483 56806388 ~ 56808544 (+)
G822470 NA non-coding downstream 65174 56870079 ~ 56871432 (+)
G822471 NA non-coding downstream 67480 56872385 ~ 56872717 (+)
G822473 NA non-coding downstream 72422 56877327 ~ 56877791 (+)
G822404 NA other upstream 41140 56762625 ~ 56763540 (+)
G822283 NA other upstream 231723 56572607 ~ 56572957 (+)
LOC110532426 NA other upstream 680495 56119005 ~ 56124213 (+)
G821409 pacsin1 other upstream 741025 56061706 ~ 56063655 (+)
LOC110532462 LOC106572392 other downstream 537496 57342345 ~ 57958962 (+)
G823373 NA other downstream 1223714 58028619 ~ 58028857 (+)
G823467 NA other downstream 1400358 58205263 ~ 58244984 (+)
G823459 LOC106572386 other downstream 1442209 58216176 ~ 58250307 (+)
LOC110532478 LOC106572378 other downstream 1583766 58385510 ~ 58390570 (+)

Expression


G822435 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G822435 Expression in each Bioproject

Bar chart with 17 bars.
G822435 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network