G823467


Basic Information

Item Value
gene id G823467
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048573.1
NCBI id CM023227.2
chromosome length 79455637
location 58205263 ~ 58244984 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU936266
ggttaaaattgatgggaagatggatggagccaaatacaggaacattctggaagaaaacctgatggagtctgcaaaagacctgagactgggacggagatttgtcttccaacaagacaatgatccaaaacataaagcaaaatctacaatggaatggttcaaaaataaacatatccaggtgttagaatggccaagtcaaagtccagacctgaatccaatcgagaatctgtggaaagaactgaaaactgctgttcacaaatgctctccatccaacctcactgagcttgcaaggaggaatgggaaaaaatgtcagtctctcaatgtgcaaaactgatagacataccccaagcgacttacagctgtaatcgcagcaaaaggtggcgctacaaagtattaacttaagggggctgaataattttgcacgcccaatttttcagtttttgatttgataaaaaagtttgaaatatccaataaatgtcgttccacttcatgattgtgtcccacttgttgttgattcttcacaaaaaaatacagttttatat

Function

NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU936266 True 539 TUCP 0.39 2 58205263 58244984
Loading

Neighbor

gene id symbol gene type direction distance location
LOC110532463 LOC106572391 coding upstream 184671 57984189 ~ 58020592 (+)
LOC110532462 LOC106572392 coding upstream 246301 57342345 ~ 57958962 (+)
LOC118966205 NA coding upstream 841777 57363432 ~ 57363486 (+)
LOC110532457 LOC106572399 coding upstream 960561 57241333 ~ 57244702 (+)
mfsd4ab mfsd4a coding upstream 981985 57217995 ~ 57223278 (+)
apex2 apex2 coding downstream 41461 58286445 ~ 58290128 (+)
LOC110532471 LOC106572384 coding downstream 53789 58298773 ~ 58321350 (+)
LOC110532474 LOC106572383 coding downstream 76617 58321601 ~ 58331563 (+)
LOC110532475 LOC106572379 coding downstream 115789 58360773 ~ 58382911 (+)
LOC110532478 LOC106572378 coding downstream 140526 58385510 ~ 58390570 (+)
G823347 NA non-coding upstream 86497 58116974 ~ 58118766 (+)
G823409 NA non-coding upstream 110983 58093184 ~ 58094280 (+)
G823397 NA non-coding upstream 129326 58069667 ~ 58075937 (+)
G823378 NA non-coding upstream 166305 58038759 ~ 58038958 (+)
G823377 NA non-coding upstream 168567 58036404 ~ 58036696 (+)
G823549 NA non-coding downstream 89667 58334651 ~ 58334911 (+)
G823551 NA non-coding downstream 91457 58336441 ~ 58336705 (+)
G823496 LOC106567247 non-coding downstream 92759 58337743 ~ 58338492 (+)
G823552 NA non-coding downstream 93510 58338494 ~ 58340182 (+)
G823554 NA non-coding downstream 96419 58341403 ~ 58346542 (+)
G823373 NA other upstream 176406 58028619 ~ 58028857 (+)
G822404 NA other upstream 1441723 56762625 ~ 56763540 (+)
G822283 NA other upstream 1632306 56572607 ~ 56572957 (+)
LOC110532427 LOC106572343 other upstream 2072327 56125754 ~ 56132936 (+)
G823459 LOC106572386 other downstream 2130 58216176 ~ 58250307 (+)
G823580 LOC106567312 other downstream 274235 58519219 ~ 58535643 (+)
LOC110532492 LOC106572441 other downstream 423170 58668090 ~ 58671251 (+)
LOC110531219 LOC106572493 other downstream 439165 58684149 ~ 58720758 (+)

Expression

G823467 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G823467 Expression in each Bioproject

Bar chart with 19 bars.
G823467 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 75.
End of interactive chart.

Co-expression Network