XLOC_027233 (ucn3l)


Basic Information

Item Value
gene id XLOC_027233
gene name ucn3l
gene type coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007115.7
NCBI id CM002888.2
chromosome length 78093715
location 15981096 ~ 15981539 (+)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00053644
ATGTGGCTAGCGCGGACCCTCCTCGCTCTGGCACTCCTTTGCGCACCAGTTTCCAGCCTCTGCTTACCAACATACGACCCCGAGCCCAACTTTCTCTGCAACAACGAGGTGTTTTCCGAGGCGAATGATAAGAGGCAGCCGACGAACTCCCTGCTGGACAGTGTAAACCTCCTCTTCAAGTCAGCTCACGCGCTTTCCTCCGAGGAGCCGCGCGAGAGGAGGACAACTCCCGCGTCCAAATACAGATACTTGAGCCAGACGCAGCTTAGAAGTAAACTGTACCGCAACAGTGCGAAGAGCGACCGACGCAGCCAGGTCACTCTATCCCTCGACGTGCCCACCAACATTATGAACATCCTCTTCAACATTGCCAAAGCCAAGAACCTGCGCGCGAAGGCGGACGACAACGCGCGTCTACTTGCGCAGATTGGAAAGAGAAAATGA

Function

symbol description
ucn3l Predicted to enable corticotropin-releasing hormone receptor binding activity. Predicted to be involved in adenylate cyclase-activating G protein-coupled receptor signaling pathway; cellular response to nutrient levels; and hormone-mediated signaling pathway. Predicted to act upstream of or within digestion. Predicted to be located in extracellular region. Predicted to be active in extracellular space. Is expressed in several structures, including brain; endocrine system; liver; retinal ganglion cell layer; and spleen. Human ortholog(s) of this gene implicated in hypertension. Orthologous to several human genes including UCN3 (urocortin 3).

GO:

id name namespace
GO:0007189 adenylate cyclase-activating G protein-coupled receptor signaling pathway biological_process
GO:0007586 digestion biological_process
GO:0031669 cellular response to nutrient levels biological_process
GO:0009755 hormone-mediated signaling pathway biological_process
GO:0005576 extracellular region cellular_component
GO:0005615 extracellular space cellular_component
GO:0051429 corticotropin-releasing hormone receptor binding molecular_function
GO:0051431 corticotropin-releasing hormone receptor 2 binding molecular_function
GO:0005179 hormone activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-060130-250 Predicted to enable corticotropin-releasing hormone receptor binding activity. Predicted to be involved in adenylate cyclase-activating G protein-coupled receptor signaling pathway; cellular response to nutrient levels; and hormone-mediated signaling pathway. Predicted to act upstream of or within digestion. Predicted to be located in extracellular region. Predicted to be active in extracellular space. Is expressed in several structures, including brain; endocrine system; liver; retinal ganglion cell layer; and spleen. Human ortholog(s) of this gene implicated in hypertension. Orthologous to several human genes including UCN3 (urocortin 3).

Ensembl:

ensembl_id ENSDARG00000087241

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00053644 True 444 mRNA 0.56 1 15981096 15981539

Neighbor

gene id symbol gene type direction distance location
XLOC_027232 si:dkey-117n7.5 coding upstream 6186 15968483 ~ 15974910 (+)
XLOC_027229 col7a1l coding upstream 14836 15889437 ~ 15966260 (+)
XLOC_027231 si:dkey-117n7.3 coding upstream 36229 15944245 ~ 15944867 (+)
XLOC_027230 si:dkey-117n7.2 coding upstream 37249 15942075 ~ 15943847 (+)
XLOC_027228 NA coding upstream 99952 15869212 ~ 15881144 (+)
XLOC_027234 copg2 coding downstream 2002 15983541 ~ 15996191 (+)
XLOC_027235 CR749763.5 coding downstream 19699 16001238 ~ 16004425 (+)
XLOC_027236 NA coding downstream 26684 16008223 ~ 16023375 (+)
XLOC_027237 NA coding downstream 55629 16037168 ~ 16073706 (+)
XLOC_027238 NA coding downstream 208787 16190326 ~ 16211867 (+)
XLOC_027225 NA non-coding upstream 740383 15183505 ~ 15240713 (+)
XLOC_027224 NA non-coding upstream 866629 15104694 ~ 15114467 (+)
XLOC_027223 NA non-coding upstream 905044 15071474 ~ 15076052 (+)
XLOC_027214 NA non-coding upstream 1210511 14767982 ~ 14770585 (+)
XLOC_027239 NA non-coding downstream 327537 16309076 ~ 16313899 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
grasscarp (Ctenopharyngodon idella) CI01000020_02648116_02648559 UCN3L coding CI01000020 null 2648029 ~ 2648559 (-)