XLOC_027242


Basic Information

Item Value
gene id XLOC_027242
gene name NA
gene type non-coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007115.7
NCBI id CM002888.2
chromosome length 78093715
location 16374269 ~ 16374692 (+)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00057141
aactccctgaacggccgccgcctcctgaactccctgaacggccgccgcctcctgaactccctgaacggccgccgcctcctgaactccctgaacggccgccgcctcctgaactccctgaacggccgctgcctcctgaactccctgaacggccgccgcctcctgaactccctgaacggccgccgcctcctgaactccctgaacggccgccgcctcctgaactccctgaacggccgccgcctcctgaactccctgaacggccgccgcctcctgaactccctgaacggccgccgcctcctgaactccctgaacggccgccgcctcctgaactccctgaacggccgccgcctcctgaactccctgaacggccgccgcctcctgaactccctgaacggccgccgcctcctgaactccctgaacggccgcc

Function

GO:

id name namespace
GO:0007492 endoderm development biological_process
GO:0043011 myeloid dendritic cell differentiation biological_process
GO:0001773 myeloid dendritic cell activation biological_process
GO:0060973 cell migration involved in heart development biological_process
GO:0060974 cell migration involved in heart formation biological_process
GO:0060975 cardioblast migration to the midline involved in heart field formation biological_process
GO:0046685 response to arsenic-containing substance biological_process
GO:0003260 cardioblast migration biological_process
GO:0060026 convergent extension biological_process
GO:0060029 convergent extension involved in organogenesis biological_process
GO:0003318 cell migration to the midline involved in heart development biological_process
GO:0097028 dendritic cell differentiation biological_process

KEGG:

id description
ko03230 Viral genome structure
ko05164 Influenza A
ko03200 Viral proteins

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00057141 True 424 lncRNA 0.70 1 16374269 16374692

Neighbor

gene id symbol gene type direction distance location
XLOC_027241 BX322608.1 coding upstream 27143 16323970 ~ 16347126 (+)
XLOC_027240 si:dkeyp-38g8.5 coding upstream 54507 16315692 ~ 16319762 (+)
XLOC_027239 NA coding upstream 60370 16309076 ~ 16313899 (+)
XLOC_027238 NA coding upstream 162402 16190326 ~ 16211867 (+)
XLOC_027237 NA coding upstream 300563 16037168 ~ 16073706 (+)
XLOC_027243 NA coding downstream 160566 16535258 ~ 16538962 (+)
XLOC_027244 pkp2 coding downstream 335309 16710001 ~ 16725144 (+)
XLOC_027245 tcp11l2 coding downstream 351268 16725960 ~ 16742893 (+)
XLOC_027246 NA coding downstream 375564 16750256 ~ 16758036 (+)
XLOC_027247 NA coding downstream 377669 16752361 ~ 16753296 (+)
XLOC_027236 NA non-coding upstream 350894 16008223 ~ 16023375 (+)
XLOC_027235 CR749763.5 non-coding upstream 369844 16001238 ~ 16004425 (+)
XLOC_027254 NA non-coding downstream 464861 16839553 ~ 16844705 (+)
XLOC_027256 NA non-coding downstream 589611 16964303 ~ 16966927 (+)

Expression


Co-expression Network