G829816



Basic Information


Item Value
gene id G829816
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048573.1
NCBI id CM023227.2
chromosome length 79455637
location 62984999 ~ 62985231 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU943537
TCAGTAAGTCAATTTAATTGAATTTGAAAAAAACCAAATATGACAAAACCAATAAAACTAAACATAGAAAATGAAGAGGAGGGAACCACTAGTCTTAAGTAATAGCACAAGGAGTTATTCTATATGTATGGCTACATAGACTGCAGAGACTGTAGATACGCAAGACTATTGTGGTGGATGTTATAAAATAAGGATTTGCTAAGAACCTCAACTTAGCACACACCGATACTGGC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU943537 True 233 lncRNA 0.34 1 62984999 62985231
Loading

Neighbor


gene id symbol gene type direction distance location
LOC101268951 tnfrsf5b coding downstream 167882 62810887 ~ 62817117 (-)
LOC110532600 LOC106572567 coding downstream 370108 62607951 ~ 62614891 (-)
LOC118966087 NA coding downstream 433317 62528929 ~ 62551682 (-)
LOC110532598 LOC106572565 coding downstream 467585 62467050 ~ 62517414 (-)
LOC110532595 LOC106572562 coding downstream 629400 62347980 ~ 62355599 (-)
LOC110532610 LOC106572636 coding upstream 12426 62997657 ~ 63001736 (-)
LOC110532613 LOC106572632 coding upstream 136461 63121692 ~ 63197214 (-)
LOC110532624 LOC106572621 coding upstream 733975 63719206 ~ 63724971 (-)
LOC110532626 LOC106572619 coding upstream 751539 63733028 ~ 63767705 (-)
LOC110532627 LOC100194719 coding upstream 782604 63767835 ~ 63791338 (-)
G829802 NA non-coding downstream 20207 62964530 ~ 62964792 (-)
G829796 NA non-coding downstream 29673 62955080 ~ 62955326 (-)
G829697 NA non-coding downstream 211492 62773275 ~ 62773507 (-)
G829687 NA non-coding downstream 223438 62761248 ~ 62761561 (-)
G829608 NA non-coding downstream 329050 62652670 ~ 62655949 (-)
G829853 LOC106572633 non-coding upstream 56619 63041850 ~ 63043353 (-)
G829992 NA non-coding upstream 286238 63271469 ~ 63271723 (-)
G830002 NA non-coding upstream 297057 63282288 ~ 63285445 (-)
G830004 NA non-coding upstream 306798 63292029 ~ 63292566 (-)
G830005 NA non-coding upstream 308381 63293612 ~ 63293837 (-)
G829644 NA other downstream 192503 62790588 ~ 62792496 (-)
tmem269 pss other downstream 1267034 61683104 ~ 61717981 (-)
G827668 NA other downstream 1912634 61028372 ~ 61072365 (-)
LOC110532567 LOC106572513 other downstream 2709258 60227530 ~ 60275772 (-)
G825961 NA other downstream 3346105 59638346 ~ 59638894 (-)
LOC110532632 LOC106572615 other upstream 877617 63862848 ~ 63899379 (-)
G830543 LOC108255233 other upstream 1042676 64027907 ~ 64041211 (-)
LOC110532670 hoxc8ab other upstream 1726441 64710256 ~ 64713744 (-)
G831986 NA other upstream 2385622 65370853 ~ 65413071 (-)
G832008 NA other upstream 2429264 65414495 ~ 65418096 (-)

Expression


G829816 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

G829816 Expression in each Bioproject

Bar chart with 2 bars.
G829816 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 7.
End of interactive chart.

Co-expression Network