G833139 (LOC100380641)



Basic Information


Item Value
gene id G833139
gene name LOC100380641
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048573.1
NCBI id CM023227.2
chromosome length 79455637
location 66814464 ~ 66821639 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU947422
GCCCGGTCTGCTTGGCCTTCTTGTTGGCGCGGCGCGTGTCCTCACGGAGCTGGATGATGACCTGCAGGACCCGCAGGAAGAACTTCTGGGTGGACGTCTTTGAGGTCAAGGAAGACATGCAGGGCAGCTGCAGCTCCCGTCCGCCCAGCGTACGCTTCTGGGCAGCCACAATCACCACGCTCTCAGAGCCGTCGAACCTGCGCCCCCGTCTGCTAGAGAGCTTGCCGGCCTTCAGCCTGGCGGAGATGGAGGTGTCCTCGGCAGGGGCGTCAGGTGACTGGGCGTCAGCCCGGGCTCTCCTCTGCTGCTCTAGGTTGTACTCCCGCAGCTCGGC

Function


NR:

description
E3 ubiquitin-protein ligase HUWE1-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU947422 True 334 TUCP 0.65 2 66814464 66821639

Neighbor


gene id symbol gene type direction distance location
LOC118966099 NA coding upstream 188639 66615300 ~ 66628653 (+)
LOC110532711 LOC106572715 coding upstream 220879 66582815 ~ 66593585 (+)
LOC110532709 myl6b coding upstream 298462 66506476 ~ 66516002 (+)
LOC118965939 NA coding upstream 332085 66481679 ~ 66482379 (+)
LOC110532708 LOC106572691 coding upstream 332920 66478086 ~ 66481544 (+)
LOC110532716 LOC106572708 coding downstream 206390 67028029 ~ 67042094 (+)
LOC110532719 ssrd coding downstream 223558 67045197 ~ 67049885 (+)
LOC110532722 LOC106572704 coding downstream 441925 67263564 ~ 67278303 (+)
LOC110532726 LOC106572718 coding downstream 658713 67480352 ~ 67580588 (+)
LOC110532729 LOC106572697 coding downstream 786034 67607673 ~ 67618114 (+)
G833142 NA non-coding upstream 20879 66793266 ~ 66793585 (+)
G833099 NA non-coding upstream 55556 66758653 ~ 66758908 (+)
G833097 NA non-coding upstream 56002 66757948 ~ 66758462 (+)
G832907 LOC106572712 non-coding upstream 63298 66675600 ~ 66751166 (+)
G832939 LOC106572712 non-coding upstream 148657 66660596 ~ 66665807 (+)
G833230 NA non-coding downstream 99363 66921002 ~ 66921794 (+)
G833239 LOC106572710 non-coding downstream 104939 66926578 ~ 66927097 (+)
G833240 LOC100846954 non-coding downstream 108052 66929691 ~ 66931359 (+)
G833271 NA non-coding downstream 198718 67020357 ~ 67021927 (+)
G833307 NA non-coding downstream 245104 67066743 ~ 67067594 (+)
G833100 LOC106613929 other upstream 54791 66759278 ~ 66759673 (+)
LOC110532701 LOC106572669 other upstream 1013633 65754497 ~ 65801814 (+)
LOC110532705 LOC106567051 other upstream 1142981 65669353 ~ 65671483 (+)
G831865 NA other upstream 1191148 65622938 ~ 65623316 (+)
G831810 NA other upstream 1299479 65514393 ~ 65514985 (+)
G833241 LOC106572720 other downstream 110049 66931688 ~ 66934487 (+)
G833541 NA other downstream 391781 67213420 ~ 67213884 (+)
G833906 LOC100194703 other downstream 799239 67620878 ~ 67621366 (+)
G834099 NA other downstream 1227274 68048913 ~ 68049222 (+)
fance fance other downstream 1395439 68213202 ~ 68218960 (+)

Expression


G833139(LOC100380641) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G833139(LOC100380641) Expression in each Bioproject

Bar chart with 14 bars.
G833139(LOC100380641) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network