G833541



Basic Information


Item Value
gene id G833541
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048573.1
NCBI id CM023227.2
chromosome length 79455637
location 67213420 ~ 67213884 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU947931
cttgtcatgtgaaatgtttaatgtctgctatccctcctgtttcctctgtctcttcttcacaggaggagcctggtgatttgacaggggtgccggaggaatatcacgatctgcgcacggtgttcagtcggtccagggccacttctcttcctccacaccggtcgtatgattgtagtattgatctccttccgggaaccactcccccccggggtagactatactctctgtcggctcccgaacgtaaggctctcgaagattatttgtctgtagctcttgccgccggtaccatagtcccctcctcctctcccgccggagcggggtttttttttgttaagaagaaggacgggtccctgcgcccctgcatagattatcgagggctgaatgacataacagtgaagaatcgttatccgcttcctcttatgtcttcagccttcgagatcctgcagggagccaggtttttcactaagc

Function


NR:

description
Retrotransposable element Tf2 protein type 1

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU947931 True 465 TUCP 0.52 1 67213420 67213884

Neighbor


gene id symbol gene type direction distance location
LOC110532719 ssrd coding upstream 163535 67045197 ~ 67049885 (+)
LOC110532716 LOC106572708 coding upstream 171326 67028029 ~ 67042094 (+)
LOC118966099 NA coding upstream 587595 66615300 ~ 66628653 (+)
LOC110532711 LOC106572715 coding upstream 619835 66582815 ~ 66593585 (+)
LOC110532709 myl6b coding upstream 697418 66506476 ~ 66516002 (+)
LOC110532722 LOC106572704 coding downstream 49680 67263564 ~ 67278303 (+)
LOC110532726 LOC106572718 coding downstream 266468 67480352 ~ 67580588 (+)
LOC110532729 LOC106572697 coding downstream 393789 67607673 ~ 67618114 (+)
tebp tebp coding downstream 408539 67622423 ~ 67625977 (+)
LOC110532731 LOC106572722 coding downstream 504293 67718177 ~ 67755296 (+)
G833540 NA non-coding upstream 814 67212328 ~ 67212606 (+)
G833516 NA non-coding upstream 31121 67181108 ~ 67182299 (+)
G833512 NA non-coding upstream 44309 67168840 ~ 67169111 (+)
G833511 NA non-coding upstream 44633 67168432 ~ 67168787 (+)
G833508 NA non-coding upstream 45966 67167255 ~ 67167454 (+)
G833569 NA non-coding downstream 44039 67257923 ~ 67258123 (+)
G833571 NA non-coding downstream 44856 67258740 ~ 67259561 (+)
G833573 LOC107696956 non-coding downstream 46323 67260207 ~ 67261100 (+)
G833582 NA non-coding downstream 82075 67295959 ~ 67298789 (+)
G833588 NA non-coding downstream 92969 67306853 ~ 67307607 (+)
G833241 LOC106572720 other upstream 278933 66931688 ~ 66934487 (+)
G833139 LOC100380641 other upstream 391781 66814464 ~ 66821639 (+)
G833100 LOC106613929 other upstream 453747 66759278 ~ 66759673 (+)
LOC110532701 LOC106572669 other upstream 1412589 65754497 ~ 65801814 (+)
LOC110532705 LOC106567051 other upstream 1541937 65669353 ~ 65671483 (+)
G833906 LOC100194703 other downstream 406994 67620878 ~ 67621366 (+)
G834099 NA other downstream 835029 68048913 ~ 68049222 (+)
fance fance other downstream 1003194 68213202 ~ 68218960 (+)
G834228 NA other downstream 1054153 68268037 ~ 68268408 (+)
G834235 NA other downstream 1073331 68287215 ~ 68288525 (+)

Expression


G833541 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

G833541 Expression in each Bioproject

Bar chart with 19 bars.
G833541 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 750.
End of interactive chart.

Co-expression Network