LOC118937089



Basic Information


Item Value
gene id LOC118937089
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048574.1
NCBI id CM023228.2
chromosome length 87811138
location 5868024 ~ 5868098 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>XR_005034483.1
TTGTGATGAATACTAAACTGAAAATAGCTGGAATTACCGTCAGATTGTACAGTGGTGATATTCGGTTTTCTGAAC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
XR_005034483.1 True 75 mRNA 0.36 1 5868024 5868098

Neighbor


gene id symbol gene type direction distance location
LOC118937090 NA coding downstream 234 5867715 ~ 5867790 (-)
LOC118937091 NA coding downstream 705 5867245 ~ 5867319 (-)
LOC118937088 NA coding downstream 987 5866959 ~ 5867037 (-)
LOC118936906 LOC106603984 coding downstream 43670 5821765 ~ 5824354 (-)
LOC110533271 LOC106591845 coding downstream 71749 5786430 ~ 5796275 (-)
pitx1 pitx1 coding upstream 92139 5960237 ~ 5971002 (-)
LOC110533286 LOC106603967 coding upstream 284586 6152684 ~ 6176005 (-)
larp1 LOC106603968 coding upstream 330424 6198522 ~ 6256673 (-)
sap30l LOC106603970 coding upstream 484699 6352797 ~ 6361051 (-)
LOC110533288 ggnbp2 coding upstream 493794 6361892 ~ 6376512 (-)
G848624 NA non-coding downstream 3241 5864444 ~ 5864783 (-)
G848617 NA non-coding downstream 20690 5846403 ~ 5847334 (-)
G848563 NA non-coding downstream 49206 5738694 ~ 5818818 (-)
G848522 NA non-coding downstream 66858 5764380 ~ 5801166 (-)
G848555 NA non-coding downstream 163957 5703859 ~ 5704067 (-)
G848634 pcbd2 non-coding upstream 50142 5918240 ~ 5931386 (-)
G848643 catsper3 non-coding upstream 68668 5936766 ~ 5937242 (-)
G848646 NA non-coding upstream 74577 5942675 ~ 5942890 (-)
G848647 NA non-coding upstream 74974 5943072 ~ 5943529 (-)
G848664 NA non-coding upstream 91106 5959204 ~ 5959529 (-)
G848524 LOC106591845 other downstream 45996 5739884 ~ 5822028 (-)
LOC118966693 NA other downstream 143214 5715285 ~ 5724923 (-)
G848149 NA other downstream 725553 5141877 ~ 5142471 (-)
G847861 NA other downstream 1055842 4810948 ~ 4812182 (-)
G847843 NA other downstream 1126436 4736529 ~ 4741588 (-)
G849438 hpd other upstream 913525 6778916 ~ 6787520 (-)
G849536 NA other upstream 1146633 7014731 ~ 7015222 (-)
LOC110533297 LOC106603951 other upstream 1212493 7080591 ~ 7308250 (-)
G849864 LOC106603950 other upstream 1572805 7400883 ~ 7443617 (-)
G850323 NA other upstream 1873204 7741302 ~ 7746624 (-)

Expression


LOC118937089 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

LOC118937089 Expression in each Bioproject

Bar chart with 2 bars.
LOC118937089 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1.5.
End of interactive chart.

Co-expression Network