trnaa-agc-4



Basic Information


Item Value
gene id trnaa-agc-4
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048574.1
NCBI id CM023228.2
chromosome length 87811138
location 47026116 ~ 47026188 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>trnaa-agc-4
gggggattagctcaaatggtagagcgctcgcttagcatgcgagaggtagcgggatcgatgcccgcatcctcca

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
trnaa-agc-4 True 73 mRNA 0.58 1 47026116 47026188

Neighbor


gene id symbol gene type direction distance location
LOC110534112 LOC106603038 coding downstream 613 47015794 ~ 47025503 (-)
LOC110534108 LOC106603043 coding downstream 170587 46828184 ~ 46855529 (-)
LOC110534102 LOC106603049 coding downstream 319618 46693006 ~ 46706498 (-)
LOC110534103 NA coding downstream 335840 46685597 ~ 46690276 (-)
LOC110534100 LOC106603048 coding downstream 364313 46647133 ~ 46661803 (-)
LOC110534115 LOC106603035 coding upstream 19363 47045551 ~ 47055663 (-)
LOC110534116 LOC106603034 coding upstream 42511 47068699 ~ 47121636 (-)
LOC110534118 LOC106603020 coding upstream 177053 47203241 ~ 47234608 (-)
LOC110534119 LOC107684715 coding upstream 221949 47248137 ~ 47257617 (-)
LOC110534122 NA coding upstream 356860 47383048 ~ 47384395 (-)
G895551 NA non-coding downstream 10449 47015272 ~ 47015667 (-)
G895476 NA non-coding downstream 53985 46971910 ~ 46972131 (-)
G895471 NA non-coding downstream 56662 46969097 ~ 46969454 (-)
G895373 NA non-coding downstream 128296 46895900 ~ 46897820 (-)
G895411 NA non-coding downstream 141388 46884485 ~ 46884728 (-)
G895570 NA non-coding upstream 33160 47059348 ~ 47059588 (-)
G895576 NA non-coding upstream 37544 47063732 ~ 47064151 (-)
G895578 NA non-coding upstream 39887 47066075 ~ 47066477 (-)
G896374 NA non-coding upstream 106001 47132189 ~ 47132655 (-)
G896376 NA non-coding upstream 107483 47133671 ~ 47133897 (-)
G894917 NA other downstream 1107777 45917279 ~ 45918339 (-)
LOC110534046 LOC107567170 other downstream 1275785 45747090 ~ 45751405 (-)
LOC110534025 LOC106603111 other downstream 2010069 45011329 ~ 45017446 (-)
G893541 NA other downstream 2257044 44768450 ~ 44769072 (-)
LOC110534000 frmd8 other downstream 2717183 44303605 ~ 44308978 (-)
G896841 NA other upstream 961573 47987761 ~ 47989076 (-)
LOC110534172 LOC106602940 other upstream 1855539 48881449 ~ 48907973 (-)
G899409 NA other upstream 3130004 50156192 ~ 50156902 (-)
G899421 NA other upstream 3156208 50182396 ~ 50182788 (-)

Expression


trnaa-agc-4 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

Co-expression Network