trnae-cuc-157



Basic Information


Item Value
gene id trnae-cuc-157
gene name NA
gene type misc
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048574.1
NCBI id CM023228.2
chromosome length 87811138
location 73091418 ~ 73091714 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>trnae-cuc-157
tccctggtggtctagtggttaggattcggcgctctcaccgccgcggcctgggttcgattcccggtcagggaa
>TU1050187
cgcggcctgggttcgattcccggtcagggaaatagtctatgctccttgtttacttgtgcaacctgtcactatgaatttagtaggttgttgcacatatgtaccacttcaaattgcaaactgatttgccctgcagtgtccttcccaggtgttctagtggtgcaccagaccctcctgcagcaaagcacatgatgctgtgcttcacggttgggatgtgttctttggcttgcgagccttccccttttcgatataggactcg

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
trnae-cuc-157 False 72 mRNA 0.64 1 73091643 73091714
TU1050187 True 256 lncRNA 0.50 1 73091418 73091673
Loading

Neighbor


gene id symbol gene type direction distance location
trnae-cuc-156 NA coding downstream 1145 73090427 ~ 73090498 (-)
trnak-cuu-6 NA coding downstream 2191 73089381 ~ 73089452 (-)
trnae-cuc-155 NA coding downstream 2372 73089200 ~ 73089271 (-)
trnae-cuc-154 NA coding downstream 3414 73088158 ~ 73088229 (-)
trnae-cuc-153 NA coding downstream 3603 73087969 ~ 73088040 (-)
trnae-cuc-158 NA coding upstream 114 73091828 ~ 73091898 (-)
trnae-cuc-159 NA coding upstream 483 73092197 ~ 73092268 (-)
trnae-cuc-160 NA coding upstream 663 73092377 ~ 73092448 (-)
trnae-cuc-161 NA coding upstream 1696 73093410 ~ 73093481 (-)
trnae-cuc-162 NA coding upstream 1877 73093591 ~ 73093662 (-)
G923368 NA non-coding downstream 1804 73089622 ~ 73089839 (-)
G923366 NA non-coding downstream 11524 73079919 ~ 73080119 (-)
G923365 NA non-coding downstream 47843 73043579 ~ 73043800 (-)
G923360 NA non-coding downstream 112711 72978491 ~ 72978932 (-)
LOC110534768 LOC106610378 non-coding downstream 123091 72967808 ~ 72973302 (-)
G923370 NA non-coding upstream 1536 73093250 ~ 73093632 (-)
LOC110533210 LOC106602234 non-coding upstream 8230 73099933 ~ 73135576 (-)
G923509 NA non-coding upstream 58865 73150579 ~ 73150805 (-)
G923514 NA non-coding upstream 78680 73170394 ~ 73171714 (-)
G923516 NA non-coding upstream 83987 73175701 ~ 73176299 (-)
G923192 LOC106610383 other downstream 165909 72905577 ~ 72928468 (-)
LOC110514144 LOC106602209 other downstream 1327723 71747636 ~ 71765505 (-)
LOC110534950 LOC106595337 other downstream 1343759 71744768 ~ 71752698 (-)
LOC118936746 LOC106602209 other downstream 1428509 71658344 ~ 71665901 (-)
LOC118936934 LOC106597769 other downstream 1494498 71595152 ~ 71597145 (-)
G924041 NA other upstream 538428 73630142 ~ 73631970 (-)
LOC110517287 LOC106601385 other upstream 1825463 74890707 ~ 74932952 (-)
LOC118966654 LOC106597013 other upstream 1846191 74933999 ~ 74970163 (-)
LOC118936366 LOC106566139 other upstream 1961402 75053116 ~ 75056174 (-)
G925211 NA other upstream 2192277 75283991 ~ 75284673 (-)

Expression


trnae-cuc-157 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 12.
End of interactive chart.

trnae-cuc-157 Expression in each Bioproject

Bar chart with 7 bars.
trnae-cuc-157 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 250.
End of interactive chart.

Co-expression Network