G846797



Basic Information


Item Value
gene id G846797
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048574.1
NCBI id CM023228.2
chromosome length 87811138
location 3684041 ~ 3684271 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU964669
ttggccagtctgagttatggctttttctttgcaactctgcctgacgttgagactggtgttttgcgggtactatttaatgaagctgccagttgaggacttgttaaacatctgtttctcaaactagacactctaatgtacttgtcctcttgctcggttgtgcaccagggcctcccactcctctttctattctggttagagccagtttgctctgttcggtgaagggagtagtac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU964669 True 231 lncRNA 0.46 1 3684041 3684271
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118936904 NA coding upstream 407885 3274308 ~ 3276156 (+)
LOC110534830 LOC104929447 coding upstream 531957 3137255 ~ 3152422 (+)
LOC118937045 NA coding upstream 544595 3139321 ~ 3139446 (+)
LOC118936910 LOC106604006 coding upstream 556268 3122944 ~ 3127773 (+)
smg6 LOC106563799 coding downstream 57617 3741888 ~ 3782776 (+)
LOC118966686 LOC106603991 coding downstream 125073 3809344 ~ 3818548 (+)
LOC110491263 LOC106592572 coding downstream 148775 3833046 ~ 3845145 (+)
LOC118966687 NA coding downstream 160963 3845234 ~ 3848712 (+)
LOC110492874 LOC106563797 coding downstream 182492 3866763 ~ 3902898 (+)
G846790 NA non-coding upstream 7037 3676553 ~ 3677004 (+)
G846787 NA non-coding upstream 11258 3672565 ~ 3672783 (+)
G846761 NA non-coding upstream 49969 3633431 ~ 3634072 (+)
G846730 NA non-coding upstream 55088 3562212 ~ 3628953 (+)
G846806 NA non-coding downstream 36567 3720838 ~ 3723509 (+)
G846810 NA non-coding downstream 51115 3735386 ~ 3735844 (+)
G846815 NA non-coding downstream 71010 3755281 ~ 3755683 (+)
G846820 NA non-coding downstream 83428 3767699 ~ 3768794 (+)
G846821 NA non-coding downstream 85649 3769920 ~ 3770953 (+)
G846685 NA other upstream 207728 3475738 ~ 3476313 (+)
G846588 NA other upstream 373287 3310356 ~ 3310754 (+)
LOC118966684 ubl3 other upstream 624016 3001159 ~ 3060025 (+)
G846391 NA other upstream 644793 3038376 ~ 3039248 (+)
LOC110533231 bafb other upstream 1236497 2440834 ~ 2447544 (+)
G847251 NA other downstream 316305 4000576 ~ 4000898 (+)
G847266 NA other downstream 363171 4045866 ~ 4076328 (+)
G847933 NA other downstream 1298478 4982749 ~ 4989317 (+)
G848054 NA other downstream 1450068 5134339 ~ 5135483 (+)
G848082 NA other downstream 1497821 5182092 ~ 5183370 (+)

Expression


G846797 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

G846797 Expression in each Bioproject

Bar chart with 15 bars.
G846797 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network