G848689



Basic Information


Item Value
gene id G848689
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048574.1
NCBI id CM023228.2
chromosome length 87811138
location 5998821 ~ 5999151 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU967064
tgtatgcatagtcactttaaccatatctacatgtacatactacctacatgtacatactactaaccggtgtctgtatatagcctcgctactgtatatagcctctctactgtatatagcctctctactgtatatagcctctctactgttagagcctctctactgtatagagcctctctactgttatagcctctctactgtatatagcctctctactgtatatagcctctctactgtatatagcctctctactgtatatagcctgtctttttactgttgttttatttctttacttacctattgttcacctaataccttttttgctctattggtt

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU967064 True 331 lncRNA 0.37 1 5998821 5999151
Loading

Neighbor


gene id symbol gene type direction distance location
pitx1 pitx1 coding downstream 27819 5960237 ~ 5971002 (-)
LOC118937089 NA coding downstream 130723 5868024 ~ 5868098 (-)
LOC118937090 NA coding downstream 131031 5867715 ~ 5867790 (-)
LOC118937091 NA coding downstream 131502 5867245 ~ 5867319 (-)
LOC118937088 NA coding downstream 131784 5866959 ~ 5867037 (-)
LOC110533286 LOC106603967 coding upstream 153533 6152684 ~ 6176005 (-)
larp1 LOC106603968 coding upstream 199371 6198522 ~ 6256673 (-)
sap30l LOC106603970 coding upstream 353646 6352797 ~ 6361051 (-)
LOC110533288 ggnbp2 coding upstream 362741 6361892 ~ 6376512 (-)
pigw pigw coding upstream 380436 6379587 ~ 6382385 (-)
G848686 NA non-coding downstream 1968 5996593 ~ 5996853 (-)
G848685 NA non-coding downstream 2832 5995669 ~ 5995989 (-)
G848682 NA non-coding downstream 5051 5993250 ~ 5993770 (-)
G848675 NA non-coding downstream 13808 5984800 ~ 5985013 (-)
G848664 NA non-coding downstream 39292 5959204 ~ 5959529 (-)
G848721 NA non-coding upstream 33406 6032557 ~ 6033003 (-)
G848744 NA non-coding upstream 61829 6060980 ~ 6061394 (-)
G848766 NA non-coding upstream 77851 6077002 ~ 6077286 (-)
G848775 NA non-coding upstream 95363 6094514 ~ 6094794 (-)
G848776 NA non-coding upstream 96063 6095214 ~ 6096390 (-)
G848524 LOC106591845 other downstream 176793 5739884 ~ 5822028 (-)
LOC118966693 NA other downstream 274011 5715285 ~ 5724923 (-)
G848149 NA other downstream 856350 5141877 ~ 5142471 (-)
G847861 NA other downstream 1186639 4810948 ~ 4812182 (-)
G847843 NA other downstream 1257233 4736529 ~ 4741588 (-)
G849438 hpd other upstream 782472 6778916 ~ 6787520 (-)
G849536 NA other upstream 1015580 7014731 ~ 7015222 (-)
LOC110533297 LOC106603951 other upstream 1081440 7080591 ~ 7308250 (-)
G849864 LOC106603950 other upstream 1441752 7400883 ~ 7443617 (-)
G850323 NA other upstream 1742151 7741302 ~ 7746624 (-)

Expression


G848689 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G848689 Expression in each Bioproject

Bar chart with 17 bars.
G848689 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network