G849779



Basic Information


Item Value
gene id G849779
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048574.1
NCBI id CM023228.2
chromosome length 87811138
location 7326368 ~ 7331775 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU968383
cataaacaagcagaatggattaccgtgattaatggacagtccagcatgcatcagctatgtagccaagtgatcagtgtccaaggggcagcggtggatggggcagggaagctggactggcgagtgttatccaggttagaaaactaacaatgactaaatagcttgtagccagttagctggttagcttctggaggttcttgagtgtgttctaaaaatgtaaagataatagcggttccgtatcacattgggtgaggcaggttaccggaaggtataaacaaattaaaaatcgaaaagggatagaaagtaaatatgggttcagtgagtgtttgggacgcggcgattcagacggttagcaggcctgtgctaacaagctaacagttagtagacggtgctaaacacggtagcagttagcggaccgggctaaacaagctagcagttagcaggccgaatttgcaagcaaggagatagcaagggctagagagttagcctttggggacgtcgcgatggggggagtctgtttattcctcttcatgcggtgacatcgatggaccggtcgtgggtctggatattgtagcccaggagctcaaaatgttccgtttgcgatgggaatccggggatgaaaaataaaaataaaataataaataggtccgttatgctctggttagagtcgcgttgttcgaactggcgagagctttccgagctaaaggttagctgatgaccggttagctgaagaccgctagcaatgttttgctgaagctggtagttagttggctagcttcagttg

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU968383 True 781 lncRNA 0.47 2 7326368 7331775

Neighbor


gene id symbol gene type direction distance location
LOC110533297 LOC106603951 coding downstream 18118 7080591 ~ 7308250 (-)
hsf5 LOC106603959 coding downstream 284446 7036198 ~ 7041922 (-)
LOC118966700 NA coding downstream 312186 7007920 ~ 7014182 (-)
LOC118966702 NA coding downstream 315333 7009440 ~ 7011035 (-)
LOC118966699 NA coding downstream 319909 7002865 ~ 7006459 (-)
LOC100136697 LOC100136697 coding upstream 125529 7457304 ~ 7469939 (-)
LOC110533304 LOC106603946 coding upstream 149839 7481614 ~ 7670778 (-)
LOC110533309 NA coding upstream 343004 7674779 ~ 7682828 (-)
LOC110533307 LOC106603944 coding upstream 353114 7684889 ~ 7693572 (-)
dhx33 dhx33 coding upstream 362074 7660924 ~ 7725035 (-)
G849774 NA non-coding downstream 2695 7323439 ~ 7323673 (-)
G849767 NA non-coding downstream 27056 7298667 ~ 7299312 (-)
G849743 NA non-coding downstream 89471 7236112 ~ 7236897 (-)
G849729 NA non-coding downstream 119348 7206766 ~ 7207020 (-)
G849835 NA non-coding upstream 4367 7336142 ~ 7411019 (-)
G849838 NA non-coding upstream 11121 7342896 ~ 7344906 (-)
G849844 NA non-coding upstream 27183 7358958 ~ 7359448 (-)
G849847 NA non-coding upstream 34148 7365923 ~ 7389924 (-)
G849864 LOC106603950 non-coding upstream 69108 7400883 ~ 7443617 (-)
G849536 NA other downstream 311146 7014731 ~ 7015222 (-)
G849438 hpd other downstream 538848 6778916 ~ 6787520 (-)
G848524 LOC106591845 other downstream 1504340 5739884 ~ 5822028 (-)
LOC118966693 NA other downstream 1601558 5715285 ~ 5724923 (-)
G850323 NA other upstream 409527 7741302 ~ 7746624 (-)
G850763 NA other upstream 1099756 8431531 ~ 8432041 (-)
G852802 NA other upstream 3130481 10462256 ~ 10462650 (-)
G853244 NA other upstream 3673334 11005109 ~ 11005658 (-)

Expression


G849779 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G849779 Expression in each Bioproject

Bar chart with 20 bars.
G849779 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network