G853243



Basic Information


Item Value
gene id G853243
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048574.1
NCBI id CM023228.2
chromosome length 87811138
location 11004742 ~ 11005027 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU972515
cttaccctagtaaaactgactatcctaccgatcctcaactttggcaaagtcatctacaaaatagcttccaacactctactcagcaaactggatgcagtctatcacagtgccatccgttttgttaccaaatcaccttataccacccaccactgcgacctgtatgctctagtcggctggccctcgctacatattcgtcgccagacccactggctccaggtcatctataagtctatgctgggtaaagctccgccttatctcagttcactggtcacgataacaacaaccc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU972515 True 286 lncRNA 0.48 1 11004742 11005027
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110533336 LOC106603872 coding downstream 10949 10988789 ~ 10993793 (-)
LOC110533330 LOC106603879 coding downstream 154909 10760682 ~ 10849833 (-)
LOC118966706 NA coding downstream 295666 10707542 ~ 10709076 (-)
LOC118936914 NA coding downstream 455441 10547571 ~ 10549301 (-)
LOC110533324 LOC106603889 coding downstream 849500 10146911 ~ 10155242 (-)
bod1 LOC106603873 coding upstream 21060 11026087 ~ 11029511 (-)
LOC118936915 NA coding upstream 84994 11090021 ~ 11091274 (-)
LOC110533343 LOC106603867 coding upstream 462354 11467381 ~ 11474701 (-)
LOC110533344 LOC106603866 coding upstream 556909 11561936 ~ 11564213 (-)
LOC110533345 LOC106603865 coding upstream 562466 11567493 ~ 11583280 (-)
G853238 NA non-coding downstream 3758 11000616 ~ 11000984 (-)
G853237 NA non-coding downstream 7063 10997299 ~ 10997679 (-)
G853222 NA non-coding downstream 41161 10963276 ~ 10963581 (-)
G853202 NA non-coding downstream 99711 10904611 ~ 10905031 (-)
G853179 NA non-coding downstream 140449 10863951 ~ 10864293 (-)
G853252 NA non-coding upstream 11157 11016184 ~ 11016474 (-)
G853265 NA non-coding upstream 27142 11032169 ~ 11032394 (-)
G853271 NA non-coding upstream 31305 11036332 ~ 11036622 (-)
G853276 NA non-coding upstream 36163 11041190 ~ 11041391 (-)
G852802 NA other downstream 542092 10462256 ~ 10462650 (-)
G850763 NA other downstream 2572701 8431531 ~ 8432041 (-)
G850323 NA other downstream 3258118 7741302 ~ 7746624 (-)
G849864 LOC106603950 other downstream 3561125 7400883 ~ 7443617 (-)
LOC110533297 LOC106603951 other downstream 3872177 7080591 ~ 7308250 (-)
G853244 NA other upstream 82 11005109 ~ 11005658 (-)
G853740 NA other upstream 437225 11442252 ~ 11442590 (-)
G854016 LOC106603864 other upstream 610229 11615256 ~ 11620922 (-)
G854402 NA other upstream 780093 11785120 ~ 11785853 (-)

Expression


G853243 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

G853243 Expression in each Bioproject

Bar chart with 20 bars.
G853243 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1000.
End of interactive chart.

Co-expression Network